HFE (NM_139004) Human 3' UTR Clone

CAT#: SC211811

Reviews ()
Write a review

3`UTR clone of hemochromatosis (HFE) transcript variant 4 for miRNA target validation

USD 540.00


Availability*
4 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name HFE (NM_139004) Human 3' UTR Clone
Vector pMirTarget
E. coli Selection Kanamycin (25 ug/mL)
Cell Selection Neomycin
Symbol HFE
Synonyms HFE1; HH; HLA-H; MVCD7; TFQTL2
ACCN NM_139004
Insert Size 1033
Sequence Data
>SC211811 3'UTR clone of NM_139004
The sequence shown below is from the reference sequence of NM_139004. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CGTCTTAGCTGAACGTGAGTGACACGCAGCCTGCAGACTCACTGTGGGAAGGAGACAAAACTAGAGACTC
AAAGAGGGAGTGCATTTATGAGCTCTTCATGTTTCAGGAGAGAGTTGAACCTAAACATAGAAATTGCCTG
ACGAACTCCTTGATTTTAGCCTTCTCTGTTCATTTCCTCAAAAAGATTTCCCCATTTAGGTTTCTGAGTT
CCTGCATGCCGGTGATCCCTAGCTGTGACCTCTCCCCTGGAACTGTCTCTCATGAACCTCAAGCTGCATC
TAGAGGCTTCCTTCATTTCCTCCGTCACCTCAGAGACATACACCTATGTCATTTCATTTCCTATTTTTGG
AAGAGGACTCCTTAAATTTGGGGGACTTACATGATTCATTTTAACATCTGAGAAAAGCTTTGAACCCTGG
GACGTGGCTAGTCATAACCTTACCAGATTTTTACACATGTATCTATGCATTTTCTGGACCCGTTCAACTT
TTCCTTTGAATCCTCTCTCTGTGTTACCCAGTAACTCATCTGTCACCAAGCCTTGGGGATTCTTCCATCT
GATTGTGATGTGAGTTGCACAGCTATGAAGGCTGTACACTGCACGAATGGAAGAGGCACCTGTCCCAGAA
AAAGCATCATGGCTATCTGTGGGTAGTATGATGGGTGTTTTTAGCAGGTAGGAGGCAAATATCTTGAAAG
GGGTTGTGAAGAGGTGTTTTTTCTAATTGGCATGAAGGTGTCATACAGATTTGCAAAGTTTAATGGTGCC
TTCATTTGGGATGCTACTCTAGTATTCCAGACCTGAAGAATCACAATAATTTTCTACCTGGTCTCTCCTT
GTTCTGATAATGAAAATTATGATAAGGATGATAAAAGCACTTACTTCGTGTCCGACTCTTCTGAGCACCT
ACTTACATGCATTACTGCATGCACTTCTTACAATAATTCTATGAGATAGGTACTATTATCCCCATTTCTT
TTTTAAATGAAGAAAGTGAAGTAGGCCGGGCACGGTGGCTCACGCCTGTAATC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_139004.2
Synonyms HFE1; HH; HLA-H; MVCD7; TFQTL2
Summary The protein encoded by this gene is a membrane protein that is similar to MHC class I-type proteins and associates with beta2-microglobulin (beta2M). It is thought that this protein functions to regulate iron absorption by regulating the interaction of the transferrin receptor with transferrin. The iron storage disorder, hereditary haemochromatosis, is a recessive genetic disorder that results from defects in this gene. At least nine alternatively spliced variants have been described for this gene. Additional variants have been found but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Locus ID 3077

Documents

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
40% off proteins and antibodies
68 Mouse Clones