Glutamate receptor ionotropic, NMDA 2D(GRIN2D) (NM_000836) Human 3' UTR Clone

CAT#: SC211770

3`UTR clone of glutamate receptor ionotropic N-methyl D-aspartate 2D (GRIN2D) for miRNA target validation

Need custom modification / cloning service?
Get a free quote

USD 526.00


Availability*
5 Days

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Glutamate receptor ionotropic, NMDA 2D(GRIN2D) (NM_000836) Human 3' UTR Clone
Vector pMirTarget
Symbol GRIN2D
Synonyms EB11; GluN2D; NMDAR2D; NR2D
ACCN NM_000836
Insert Size 1000
Sequence Data
>SC211770 3'UTR clone of NM_000836
The sequence shown below is from the reference sequence of NM_000836. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GCACTTCTCTAGCCTCGAGTCCGAGGTATGACGCGGCCCCGGGGGCCCCACCGCCCCCTTGGTCAGCGCA
GGCCACGGCCCGAGGGGGCGCCCGCAGTGGACAGGACCCGCGTGGGTTGGGAAGGAAAGCAGTGGAACTG
GCCGGACCCCGCCTGGAGCAGCGTCCTGCGCCCCCTGGTTCTGGAGGAACCGCAAGCCGGAGAGGATTTG
GTCCCTCAACTATCACCCAGCCTGAGAACGAGGGGGCGGGGGCCTTGGAGCCCACCGGACTTTTTTTTAA
ACCCGACAAGGGCTTTTTAACGTCACCAGATGGGGCGGGAGGTGGGGGGTTCACGCCACTCCCGCGTCCC
ACCTCCACGCCCGGGGCCGTGGCCCCCACATCACTGTGCAGCTCCCCGGCCCCAGCCGCGCCTCCGGGGA
AGCCCGTTTTTAACCTTTCATCCATTGGGACTCAAAACTGTGAGACGCGTTCGCCAAACTGTGACCCCAG
ACCTTGGCCCCGCCACACAGAAACCCCTGACCCAGACTGTGACATCCGACTCCTAAAATGGTCATCCGAC
TCCAGACTGTGACCCCTGACCCCAAACTGTGACCCGAACCCCAGACTGTGCCCCGACCAGACTGTGACCC
TTGACATCAAACCGTGACACCCCCTCCTCCTCTTCCACCCTCGGTCGCTTTTCCCTACTCTGACCTAGGA
CACGTCCCCAACGGAAGCCCCGCCTTCCCTTGCACCGCGATGAACCCAACCTCCCTGAAGCCAAAACTTC
CCACCCTGCCGCACCTCCGGACCACCCCACTTGCCACCAAGCACATCCTCTCCAAATCCAACCCTTATTT
GCGACCCTTCAGTGATGACCCAGCAGACCTCCAAAAAGCCTCCTCTGCCCAGATCTCCAGCCGGGTCTGG
GGCTGGGTTGCGGAGGGGAGGGTCTGGGAGTCCACACTTCTCCACCAACTTCCCTTCCCACTCTCTTATT
CCACATTGCAGTGTTTGGAA

CGGACCGTTACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-RsrII     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_000836.2
Synonyms EB11; GluN2D; NMDAR2D; NR2D
Summary N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of the key receptor subunit NMDAR1 (GRIN1) and 1 or more of the 4 NMDAR2 subunits: NMDAR2A (GRIN2A), NMDAR2B (GRIN2B), NMDAR2C (GRIN2C), and NMDAR2D (GRIN2D). [provided by RefSeq, Mar 2010]
Locus ID 2906
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents