NPC1L1 (NM_013389) Human 3' UTR Clone

CAT#: SC211176

3' UTR clone of NPC1 (Niemann-Pick disease type C1 gene)-like 1 (NPC1L1) transcript variant 1 for miRNA target validation


Reconstitution Protocol

USD 683.00

5 Days*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

USD 188.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00

Other products for "NPC1L1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol NPC1L1
Synonyms LDLCQ7; NPC11L1; SLC65A2
ACCN NM_013389
Insert Size 942 bp
Sequence Data
>SC211176 3’UTR clone of NM_013389
The sequence shown below is from the reference sequence of NM_013389. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTCTTGCCCAACAATGGGCGGCAGTTCTGATACAGCCAGAGGCCCTGTCTAGGCTCTATGGCCCTGAAC
CAAAGGGTTATGGGGATCTTCCTTGTGACTGCCCCTTGACACACGCCCTCCTCAAATCCTAGGGGAGGC
CATTCCCATGAGACTGCCTGTCACTGGAGGATGGCCTGCTCTTGAGGTATCCAGGCAGCACCACTGATG
GCTCCTCTGCTCCCATAGTGGGTCCCCAGTTTCCAAGTCACCTAGGCCTTGGGCAGTGCCTCCTCCTGG
GCCTGGGTCTGGAAGTTGGCAGGAACAGACACACTCCATGTTTGTCCCACACTCACTCACTTTCCTAGG
AGCCCACTTCTCATCCAACTTTTCCCTTCTCAGTTCCTCTCTCGAAAGTCTTAATTCTGTGTCAGTAAG
TCTTTAACACGTAGCAGTGTCCCTGAGAACACAGACAATGACCACTACCCTGGGTGTGATATCACAGGA
GGCCAGAGAGAGGCAAAGGCTCAGGCCAAGAGCCAACGCTGTGGGAGGCCGGTCGGCAGCCACTCCCTC
CAGGGCGCACCTGCAGGTCTGCCATCCACGGCCTTTTCTGGCAAGAGAAGGGCCCAGGAAGGATGCTCT
CATAAGGCCCAGGAAGGATGCTCTCATAAGCACCTTGGTCATGGATTAGCCCCTCCTGGAAAATGGTGT
TGGGTTTGGTCTCCAGCTCCAATACTTATTAAGGCTGTTGCTGCCAGTCAAGGCCACCCAGGAGTCTGA
AGGCTGGGAGCTCTTGGGGCTGGGCTGGTCCTCCCATCTTCACCTCGGGCCTGGATCCCAGGCCTCAAA
CCAGCCCAACCCGAGCTTTTGGACAGCTCTCCAGAAGCATGAACTGCAGTGGAGATGAAGATCCTGGCT
CTGTGCTGTGCACATAGGTGTTTAATAAACATTTGTTGGCAGAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_013389.3
Summary The protein encoded by this gene is a multi-pass membrane protein. It contains a conserved N-terminal Niemann-Pick C1 (NPC1) domain and a putative sterol-sensing domain (SSD) which includes a YQRL motif functioning as a plasma membrane to trans-Golgi network transport signal in other proteins. This protein takes up free cholesterol into cells through vesicular endocytosis and plays a critical role in the absorption of intestinal cholesterol. It also has the ability to transport alpha-tocopherol (vitamin E). The drug ezetimibe targets this protein and inhibits the absorption of intestinal cholesterol and alpha-tocopherol. In addition, this protein may play a critical role in regulating lipid metabolism. Polymorphic variations in this gene are associated with plasma total cholesterol and low-density lipoprotein cholesterol (LDL-C) levels and coronary heart disease (CHD) risk. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
Locus ID 29881
MW 33.8

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.