HLA-DRA (NM_019111) Human 3' UTR Clone

CAT#: SC205686

3' UTR clone of major histocompatibility complex class II DR alpha (HLA-DRA) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: HLA-DRA
• Synonyms: HLA-DRA1
• ACCN: NM_019111
• Insert Size: 418 bp
• Sequence Data:
  Insert Sequence

  >SC205686 3' UTR clone of NM_019111
  The sequence shown below is from the reference sequence of NM_019111. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGCAATGCAGCAGAACGCAGGGGGCCTCTGTAAGGCACATGGAGGTGATGGTGTTTCTTAGAGAGAAGAT
  CACTGAAGAAACTTCTGCTTTAATGGCTTTACAAAGCTGGCAATATTACAATCCTTGACCTCAGTGAAAG
  CAGTCATCTTCAGCATTTTCCAGCCCTATAGCCACCCCAAGTGTGGATATGCCTCTTCGATTGCTCCGTA
  CTCTAACATCTAGCTGGCTTCCCTGTCTATTGCCTTTTCCTGTATCTATTTTCCTCTATTTCCTATCATT
  TTATTATCACCATGCAATGCCTCTGGAATAAAACATACAGGAGTCTGTCTCTGCTATGGAATGCCCCATG
  GGGCATCTCTTGTGTACTTATTGTTTAAGGTTTCCTCAAACTGTGATTTTTCTGAACACAATAAACTA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_019111.3
• Summary: HLA-DRA is one of the HLA class II alpha chain paralogues. This class II molecule is a heterodimer consisting of an alpha and a beta chain, both anchored in the membrane. This molecule is expressed on the surface of various antigen presenting cells such as B lymphocytes, dendritic cells, and monocytes/macrophages, and plays a central role in the immune system and response by presenting peptides derived from extracellular proteins, in particular, pathogen-derived peptides to T cells. The alpha chain is approximately 33-35 kDa and its gene contains 5 exons. Exon 1 encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, and exon 4 encodes the transmembrane domain and the cytoplasmic tail. DRA does not have polymorphisms in the peptide binding part and acts as the sole alpha chain for DRB1, DRB3, DRB4 and DRB5. [provided by RefSeq, Aug 2020]
• Locus ID: 3122