CACNA1G (NM_198388) Human 3' UTR Clone

CAT#: SC204625

3' UTR clone of calcium channel voltage-dependent T type alpha 1G subunit (CACNA1G) transcript variant 13 for miRNA target validation


Reconstitution Protocol

USD 683.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

USD 188.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00

Other products for "CACNA1G"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol CACNA1G
Synonyms Ca(V)T.1; Cav3.1; NBR13; SCA42; SCA42ND
ACCN NM_198388
Insert Size 753 bp
Sequence Data
>SC204625 3’UTR clone of NM_198388
The sequence shown below is from the reference sequence of NM_198388. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCCTCTGACCCAGCAGACCTGGACCCCTGAGTCCTGCCCCACTTTCCCACTCACCTTTCTCCACTGGGT
GCCAAGTCCTAGCTCCTCCTCCTGGGCTATATTCCTGACAAAAGTTCCATATAGACACCAAGGAGGCGG
AGGCGCTCCTCCCTGCCTCAGTGGCTCTGGGTACCTGCAAGCAGAACTTCCAAAGAGAGTTAAAAGCAG
CAGCCCCGGCAACTCTGGCTCCAGGCAGAAGGAGAGGCCCGGTGCAGCTGAGGTTCCCGACACCAGAAG
CTGTTGGGAGAAAGCAATACGTTTGTGCAGAATCTCTATGTATATTCTATTTTATTAAATTAATTGAAT
CTAGTATATGCGGGATGTACGACATTTTGTGACTGAAGAGACTTGTTTCCTTCTACTTTTATGTGTCTC
AGAATATTTTTGAGGCGAAGGCGTCTGTCTCTTGGCTATTTTAACCTAAAATAACAGTCTAGTTATATT
CCCTCTTCTTGCAAAGCACAAGCTGGGACCGCGAGCACATTGCAGCCCCAACGGTGGCCCATCTTCAGC
GGAGAGCGAGAACCATTTTGGAAACTGTAATGTAACTTATTTTTTCCTTTAACCTCGTCATCATTTTCT
GTAGGGAAAAAAAAAAGAAAAAGAAAAAATGAGATTTTACAAGTGAAATGGAACCTTTTTATATATACA
TACATACATATCTATCTATCTATCTATATATATATAAAATAAAGTAATTTTCCTAAATAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_198388.3
Summary Voltage-sensitive calcium channels mediate the entry of calcium ions into excitable cells, and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, gene expression, cell motility, cell division, and cell death. This gene encodes a T-type, low-voltage activated calcium channel. The T-type channels generate currents that are both transient, owing to fast inactivation, and tiny, owing to small conductance. T-type channels are thought to be involved in pacemaker activity, low-threshold calcium spikes, neuronal oscillations and resonance, and rebound burst firing. Many alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Sep 2011]
Locus ID 8913
MW 29.2

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.