FXYD2 (NM_001680) Human 3' UTR Clone

CAT#: SC204168

3`UTR clone of FXYD domain containing ion transport regulator 2 (FXYD2) transcript variant a for miRNA target validation

Need custom modification / cloning service?
Get a free quote

USD 526.00


Availability*
5 Days

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name FXYD2 (NM_001680) Human 3' UTR Clone
Vector pMirTarget
Symbol FXYD2
Synonyms ATP1G1; HOMG2
ACCN NM_001680
Insert Size 334
Sequence Data
>SC204168 3'UTR clone of NM_001680
The sequence shown below is from the reference sequence of NM_001680. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GGGCAATAAGAAGCGCAGGCAAATCAATGAAGATGAGCCGTAACAGCAGCCTCGGCGGTGCCACCCACTG
CACTGGGGCCAGCTGGGAAGCCAAGCATGGCCCTGCCTCTGGCGCCTCCCCTTCTTCCCTGGGCTTTAGA
CCTTTGTCCCCGTCACTGCCAGCGCTTGGGCTGAAGGAAGCTCCAGACTCAATGTGACCCCCAGGTGGCA
TCGCCAACTCCTGCCTCGTGCCACCTCATGCTTATAATAAAGCCGGCGTCAGAGACCGCTGCTTCCCTCA
CCTGCCTGCCTGTCTCCCTCCTCTGTCACCACCAGCCTCTCCAAGCTCAAGTAC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001680.4
Synonyms ATP1G1; HOMG2
Summary May be involved in forming the receptor site for cardiac glycoside binding or may modulate the transport function of the sodium ATPase. [UniProtKB/Swiss-Prot Function]
Locus ID 486
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents