PCCA (NM_000282) Human 3' UTR Clone

CAT#: SC203823

3' UTR clone of propionyl Coenzyme A carboxylase alpha polypeptide (PCCA) nuclear gene encoding mitochondrial protein transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PCCA
• ACCN: NM_000282
• Insert Size: 299 bp
• Sequence Data:
  Insert Sequence

  >SC203823 3’UTR clone of NM_000282
  The sequence shown below is from the reference sequence of NM_000282. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  GAAGGGGATCTGCTCGTGGAGCTGGAATGAAGGATTTATAACCTTTCAGTCATCACCCAATTTAATTAG
  CCATTTGCATGATGCTTTCACACACAATTGATTCAAGCATTATACAGGAACACCCCTGTGCAGCTACGT
  TTACGTCGTCATTTATTCCACAGAGTCAAGACCAATATTCTGCCAAAAAATCACCAATGGAAATTTTCA
  TTGATATAAATACTTGTACATATGATTTGTACTTCTGCTGTGAGATTCCCTAGTGTCAAAATTAAATCA
  ATAAAACTGAGCATTTGTCTAAA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000282.4
• Summary: The protein encoded by this gene is the alpha subunit of the heterodimeric mitochondrial enzyme Propionyl-CoA carboxylase. PCCA encodes the biotin-binding region of this enzyme. Mutations in either PCCA or PCCB (encoding the beta subunit) lead to an enzyme deficiency resulting in propionic acidemia. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2010]
• Locus ID: 5095
• MW: 11.7