MIR5706 Human qPCR Primer Pair (MI0019314)

CAT#: HP301255

MIR5706 (Human) qSTAR miRNA primer pairs - 200 reactions

USD 125.00


Availability*
3 Days

Size
    • 200 rxns

Product images

Specifications

Product Data
Forward Sequence TTCTGGATAACATGCTGAAG
Reverse Sequence GAACATGTCTGCGTATCTC
Accession No MIMAT0022500
Synonyms MIR5706 hsa-mir-5706,MIMAT0022500,hsa-miR-5706,MI0019314
Component 1 vial of lyophilized qSTAR miRNA primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been pre-validated on ABI 7900HT
Storage & Stability The primer mix is stable for one year from date of shipping when stored at -20 degrees C
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents