MIR196A2 Human qPCR Primer Pair (MI0000279)
USD 189.00
3 Days*
Size
Product Images
Other products for "MIR196A2"
Specifications
Product Data | |
Gene ID | 406973 |
Forward Sequence | TAGGTAGTTTCATGTTGTTGG |
Accession No | MIMAT0000689 |
Synonyms | hsa-miR-196a2; MI0000279; MIMAT0000689; MIR196A2 hsa-mir-196a2 |
Component | 1 vial of lyophilized qSTAR miRNA primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | The primer mix is stable for one year from date of shipping. Store at -20°C. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.