Netrin 5 (NTN5) Human qPCR Primer Pair (NM_145807)

CAT#: HP217513

qSTAR qPCR primer pairs against Homo sapiens gene NTN5



SensiMix SYBR Master Mix

USD 142.00

5 Days*

Size
    • 200 reactions

Product Images

Frequently bought together (4)
NTN5 (Myc-DDK-tagged)-Human netrin 5 (NTN5)
    • 10 ug

USD 457.00


A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
    • 4 x 1.25 ml (500 rxns/20ul reaction)

USD 305.00


First Strand cDNA Synthesis Kit (11801-100)
    • 100 reactions

USD 518.00


Rabbit Polyclonal Anti-NTN5 Antibody
    • 100 ul

USD 539.00

Other products for "NTN5"

Specifications

Product Data
Gene ID 126147
Forward Sequence CTTGCCACTACTCCTGGTGCTT
Reverse Sequence AGTACCTCCGAAGGCTCATGTG
Accession No BC021210, NM_145807, NM_145807.1, NM_145807.2, BC021210.2, BC033207, BC033207.1, BC018654, BC018697, BE270224, NM_145807.3
UniProt ID Q8WTR8
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage Store at -20°C.
Stability The primer mix is stable for one year from date of shipping.

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.