CaMKI (CAMK1) Human qPCR Primer Pair (NM_003656)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
CAMK1 (Myc-DDK-tagged)-Human calcium/calmodulin-dependent protein kinase I (CAMK1)
USD 457.00
A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
USD 305.00
Other products for "CAMK1"
Specifications
Product Data | |
Gene ID | 8536 |
Forward Sequence | GGATTGCTGGTCCATAGGTGTC |
Reverse Sequence | CAGAGATGTCGTCCCAGTAAGG |
Accession No | NM_003656, NM_003656.1, NM_003656.2, NM_003656.3, NM_003656.4, BC106754, BC106755, BI546222, NM_003656.5 |
UniProt ID | Q14012 |
Synonyms | CAMKI |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM. |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.