Germany
Japan
United Kingdom
China
C6orf204 (CEP85L) Human qPCR Primer Pair (NM_001042475)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
USD 305.00
CEP85L (Myc-DDK-tagged)-Human chromosome 6 open reading frame 204 (C6orf204), transcript variant 3
USD 740.00
Other products for "CEP85L"
Specifications
| Product Data | |
| Gene ID | 387119 |
| Forward Sequence | ACAGTGGAGACACTGGCATTGG |
| Reverse Sequence | GCGCTGGAATTAGACGGCATCA |
| Accession No | NM_001042475, NM_001042475.1, NM_001042475.2, BC153054, BC036553, BC045657, BC048977, BC052778, BC064835, BC110835, BC126140, BC126142, BC148459, NM_001042475.3 |
| UniProt ID | Q5SZL2 |
| Synonyms | bA57K17.2; C6orf204; LIS10; NY-BR-15 |
| Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM. |
| Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
| Storage | Store at -20°C. |
| Stability | The primer mix is stable for one year from date of shipping. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.