Cytochrome P450 2B6 (CYP2B6) Human qPCR Primer Pair (NM_000767)

CAT#: HP200710

qSTAR qPCR primer pairs against Homo sapiens gene CYP2B6

Specifications

Product Data

• Gene ID: 1555
• Forward Sequence: ACAGTGTGGAGAAGCACCGTGA
• Reverse Sequence: GGTTGAGGTTCTGGTGGCTGAA
• Accession No: NM_000767, NM_000767.2, NM_000767.3, NM_000767.4, BC067430, BC067431, NM_000767.5
• UniProt ID: P20813
• Synonyms: CPB6; CYP2B; CYP2B7; CYP2B7P; CYPIIB6; EFVM; IIB1; P450
• Component: 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
• Quality Control: The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
• Storage: Store at -20°C.
• Stability: The primer mix is stable for one year from date of shipping.