MGMT Human Gene Knockout Kit (CRISPR)

CAT#: KN201612

Reviews ()
Write a review

MGMT - human gene knockout kit via CRISPR, HDR mediated



HDR-mediated knockout kit validation


  See Other Versions

USD 1,657.00

2 Weeks*

Size
    • 1 kit

Product images

Other products for "MGMT"

Specifications

Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Donor DNA GFP-puro
Symbol MGMT
Locus ID 4255
Kit Components

KN201612G1, MGMT gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GGTGCGCACCGTTTGCGACT

KN201612G2, MGMT gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TCGGGACGCAAAGCGTTCTA

KN201612-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

pUC vector backbone in gray; Left arm sequence in blue; GFP-puro in green; Right arm in violet

GATCGTTGGG AACCGGAGCT GAATGAAGCC ATACCAAACG ACGAGCGTGA CACCACGATG CCTGTAGCAA TGGCAACAAC GTTGCGCAAA CTATTAACTG GCGAACTACT TACTCTAGCT TCCCGGCAAC AATTAATAGA CTGGATGGAG GCGGATAAAG TTGCAGGACC ACTTCTGCGC TCGGCCCTTC CGGCTGGCTG GTTTATTGCT GATAAATCTG GAGCCGGTGA GCGTGGTTCT CGCGGTATCA TTGCAGCACT GGGGCCAGAT GGTAAGCCCT CCCGTATCGT AGTTATCTAC ACGACGGGGA GTCAGGCAAC TATGGATGAA CGAAATAGAC AGATCGCTGA GATAGGTGCC TCACTGATTA AGCATTGGTA ACTGTCAGAC CAAGTTTACT CATATATACT TTAGATTGAT TTAAAACTTC ATTTTTAATT TAAAAGGATC TAGGTGAAGA TCCTTTTTGA TAATCTCATG ACCAAAATCC CTTAACGTGA GTTTTCGTTC CACTGAGCGT CAGACCCCGT AGAAAAGATC AAAGGATCTT CTTGAGATCC TTTTTTTCTG CGCGTAATCT GCTGCTTGCA AACAAAAAAA CCACCGCTAC CAGCGGTGGT TTGTTTGCCG GATCAAGAGC TACCAACTCT TTTTCCGAAG GTAACTGGCT TCAGCAGAGC GCAGATACCA AATACTGTTC TTCTAGTGTA GCCGTAGTTA GGCCACCACT TCAAGAACTC TGTAGCACCG CCTACATACC TCGCTCTGCT AATCCTGTTA CCAGTGGCTG CTGCCAGTGG CGATAAGTCG TGTCTTACCG GGTTGGACTC AAGACGATAG TTACCGGATA AGGCGCAGCG GTCGGGCTGA ACGGGGGGTT CGTGCACACA GCCCAGCTTG GAGCGAACGA CCTACACCGA ACTGAGATAC CTACAGCGTG AGCTATGAGA AAGCGCCACG CTTCCCGAAG GGAGAAAGGC GGACAGGTAT CCGGTAAGCG GCAGGGTCGG AACAGGAGAG CGCACGAGGG AGCTTCCAGG GGGAAACGCC TGGTATCTTT ATAGTCCTGT CGGGTTTCGC CACCTCTGAC TTGAGCGTCG ATTTTTGTGA TGCTCGTCAG GGGGGCGGAG CCTATGGAAA AACGCCAGCA ACGCGGCCTT TTTACGGTTC CTGGCCTTTT GCTGGCCTTT TGCTCACATG TTCTTTCCTG CGTTATCCCC TGATTCTGTG GATAACCGTA TTACCGCCTT TGAGTGAGCT GATACCGCTC GCCGCAGCCG AACGACCGAG CGCAGCGAGT CAGTGAGCGA GGAAGCGGAA GAGCGCCCAA TACGCAAACC GCCTCTCCCC GCGCGTTGGC CGATTCATTA ATGCAGCTGG CACGACAGGT TTCCCGACTG GAAAGCGGGC AGTGAGCGCA ACGCAATTAA TGTGAGTTAG CTCACTCATT AGGCACCCCA GGCTTTACAC TTTATGCTTC CGGCTCGTAT GTTGTGTGGA ATTGTGAGCG GATAACAATT TCACACAGGA AACAGCTATG ACCATGATTA CGCCAAGCTC CTTCCTCTTC CAGCCCTTCC TCTTTCACTG ACTGACTGAC TGGAAGACAC ACCTCCCCCT GACAGGGTCT CTGCTGGTCT GGGGGTCCCT GACTAGGGGA GCGGCACCAG GAGGGGAGAG ACTCGCGCTC CGGGCTCAGC GTAGCCGCCC CGAGCAGGAC CGGGATTCTC ACTAAGCGGG CGCCGTCCTA CGACCCCCGC GCGCTTTCAG GACCACTCGG GCACGTGGCA GGTCGCTTGC ACGCCCGCGG ACTATCCCTG TGACAGGAAA AGGTACGGGC CATTTGGCAA ACTAAGGCAC AGAGCCTCAG GCGGAAGCTG GGAAGGCGCC GCCCGGCTTG TACCGGCCGA AGGGCCATCC GGGTCAGGCG CACAGGGCAG CGGCGCTGCC GGAGGACCAG GGCCGGCGTG CCGGCGTCCA GCGAGGATGC GCAGACTGCC TCAGGCCCGG CGCCGCCGCA CAGGGCATGC GCCGACCCGG TCGGGCGGGA ACACCCCGCC CCTCCCGGGC TCCGCCCCAG CTCCGCCCCC GCGCGCCCCG GCCCCGCCCC CGCGCGCTCT CTTGCTTTTC TCAGGTCCTC GGCTCCGCCC CGCTCTAGAC CCCGCCCCAC GCCGCCATCC CCGTGCCCCT CGGCCCCGCC CCCGCGCCCC GGATACTAGC ATGGAGAGCG ACGAGAGCGG CCTGCCCGCC ATGGAGATCG AGTGCCGCAT CACCGGCACC CTGAACGGCG TGGAGTTCGA GCTGGTGGGC GGCGGAGAGG GCACCCCCGA GCAGGGCCGC ATGACCAACA AGATGAAGAG CACCAAAGGC GCCCTGACCT TCAGCCCCTA CCTGCTGAGC CACGTGATGG GCTACGGCTT CTACCACTTC GGCACCTACC CCAGCGGCTA CGAGAACCCC TTCCTGCACG CCATCAACAA CGGCGGCTAC ACCAACACCC GCATCGAGAA GTACGAGGAC GGCGGCGTGC TGCACGTGAG CTTCAGCTAC CGCTACGAGG CCGGCCGCGT GATCGGCGAC TTCAAGGTGA TGGGCACCGG CTTCCCCGAG GACAGCGTGA TCTTCACCGA CAAGATCATC CGCAGCAACG CCACCGTGGA GCACCTGCAC CCCATGGGCG ATAACGATCT GGATGGCAGC TTCACCCGCA CCTTCAGCCT GCGCGACGGC GGCTACTACA GCTCCGTGGT GGACAGCCAC ATGCACTTCA AGAGCGCCAT CCACCCCAGC ATCCTGCAGA ACGGGGGCCC CATGTTCGCC TTCCGCCGCG TGGAGGAGGA TCACAGCAAC ACCGAGCTGG GCATCGTGGA GTACCAGCAC GCCTTCAAGA CCCCGGATGC AGATGCCGGT GAAGAAAGAG TTTAAGAATT CCGATCATAT TCAATAACCC TTAATATAAC TTCGTATAAT GTATGCTATA CGAAGTTATT AGGTCTGAAG AGGAGTTTAC GTCCAGCCAA GCTTAGGATC TCGACCTCGA AATTCTACCG GGTAGGGGAG GCGCTTTTCC CAAGGCAGTC TGGAGCATGC GCTTTAGCAG CCCCGCTGGG CACTTGGCGC TACACAAGTG GCCTCTGGCC TCGCACACAT TCCACATCCA CCGGTAGGCG CCAACCGACT CCGTTCTTTG GTGGCCCCTT CGCGCCACCT TCTACTCCTC CCCTAGTCAG GAAGTTCCCC CCCGCCCCGC AGCTCGCGTC GTGCAGGACG TGACAAATGG AAGTAGCACG TCTCACTAGT CTCGTGCAGA TGGACAGCAC CGCTGAGCAA TGGAAGCGGG TAGGCCTTTG GGGCAGCGGC CAATAGCAGC TTTGCTCCTT CGCTTTCTGG GCTCAGAGGC TGGGAAGGGG TGGGTCCGGG GGCGGGCTCA GGGGCGGGCT CAGGGGCGGG GCGGGCGCCC GAAGGTCCTC CGGAGGCCCG GCATTCTGCA CGCTTCAAAA GCGCACGTCT GCCGCGCTGT TCTCCTCTTC CTCATCTCCG GGCCTTTCGA CCTGCATCCA TCTAGATCTC GAGCAGCTGA AGCTTACCAT GACCGAGTAC AAGCCCACGG TGCGCCTCGC CACCCGCGAC GACGTCCCCA GGGCCGTACG CACCCTCGCC GCCGCGTTCG CCGACTACCC CGCCACGCGC CACACCGTCG ATCCGGACCG CCACATCGAG CGGGTCACCG AGCTGCAAGA ACTCTTCCTC ACGCGCGTCG GGCTCGACAT CGGCAAGGTG TGGGTCGCGG ACGACGGCGC CGCGGTGGCG GTCTGGACCA CGCCGGAGAG CGTCGAAGCG GGGGCGGTGT TCGCCGAGAT CGGCCCGCGC ATGGCCGAGT TGAGCGGTTC CCGGCTGGCC GCGCAGCAAC AGATGGAAGG CCTCCTGGCG CCGCACCGGC CCAAGGAGCC CGCGTGGTTC CTGGCCACCG TCGGCGTCTC GCCCGACCAC CAGGGCAAGG GTCTGGGCAG CGCCGTCGTG CTCCCCGGAG TGGAGGCGGC CGAGCGCGCC GGGGTGCCCG CCTTCCTGGA GACCTCCGCG CCCCACAACC TCCCCTTCTA CGAGCGGCTC GGCTTCACCG TCACCGCCGA CGTCGAGGTG CCCGAAGGAC CGCGCACCTG GTGCATGACC CGCAAGCCCG GTGCCTGACG CCCGCCCCAC GACCCGCAGC GCCCGACCGA AAGGAGCGCA CGACCCCATG CATCGATGAT ATCAGATCCC CGGGATGCAG AAATTGATGA TCTATTAAAC AATAAAGATG TCCACTAAAA TGGAAGTTTT TCCTGTCATA CTTTGTTAAG AAGGGTGAGA ACAGAGTACC TACATTTTGA ATGGAAGGAT TGGAGCTACG GGGGTGGGGG TGGGGTGGGA TTAGATAAAT GCCTGCTCTT TACTGAAGGC TCTTTACTAT TGCTTTATGA TAATGTTTCA TAGTTGGATA TCATAATTTA AACAAGCAAA ACCAAATTAA GGGCCAGCTC ATTCCTCCCA CTCATGATCT ATAGATCTAT AGATCTCTCG TGGGATCATT GTTTTTCTCT TGATTCCCAC TTTGTGGTTC TAAGTACTGT GGTTTCCAAA TGTGTCAGTT TCATAGCCTG AAGAACGAGA TCAGCAGCCT CTGTTCCACA TACACTTCAT TCTCAGTATT GTTTTGCCAA GTTCTAATTC CATCAGAAGC TGGTCGAGAT CCGGAACCCT TAATATAACT TCGTATAATG TATGCTATAC GAAGTTATTA GGTCCCTCGA AGAGGTTCAC TAGGCGCGCC TCGCTCCCGG AAGAGTGCGG AGCTCTCCCT CGGGACGGTG GCAGCCTCGA GTGGTCCTGC AGGCGCCCTC ACTTCGCCGT CGGGTGTGGG GCCGCCCTGA CCCCCACCCA TCTCGGGCGA GCTCCAGGTG CGCCCCAAGT GCCTCCCAGG TGTTGCCCAG CCTTTCCCCG GGCCTGGGGT TCCTGGACTA GGCTGCGCTG CAGTGACTGT GGACTGGCGT GTGGCGGGGG TCGTGGCAGC CCCTGCCTTA CCTCTAGGTG CCAGCCCCAG GCCCGGGCCC CGGGTTCTTC CTACCCTTCC ATGCTGCCAG CTTTCCCTCC GCCAGCTGCT CCAGGAAGCT TCCAGAAGCC CCTGCGCGGG CCTTGGCTTG CAGCAACCCT TTAGCATACT TAGGCAGAGT CCCATATTTC CTTCCTGCTG GAGGCCAAGT TCTAGGGGCC TTCTGGTTAC TATGGCTGGT GTTTGTGTAC ATCATACCCT AACTGTATTC ATCAACACTT AGAGTAAGCA AGGCTCGCTG GAGAGCCACA CACACTGGGC ACCGTAATGT CGGTTATAAC ACCGCAGAGG AGTTCTGAAC TATGTATTTC GCACTCCTGG ACGACAGTCT TCACTGACTG ACTGACTGGA AAGTCCTCTC CACTGACTGT AGCCTCCAAT TCACTGGCCG TCGTTTTACA ACGTCGTGAC TGGGAAAACC CTGGCGTTAC CCAACTTAAT CGCCTTGCAG CACATCCCCC TTTCGCCAGC TGGCGTAATA GCGAAGAGGC CCGCACCGAT CGCCCTTCCC AACAGTTGCG CAGCCTGAAT GGCGAATGGC GCCTGATGCG GTATTTTCTC CTTACGCATC TGTGCGGTAT TTCACACCGC ATACGTCAAA GCAACCATAG TACGCGCCCT GTAGCGGCGC ATTAAGCGCG GCGGGTGTGG TGGTTACGCG CAGCGTGACC GCTACACTTG CCAGCGCCCT AGCGCCCGCT CCTTTCGCTT TCTTCCCTTC CTTTCTCGCC ACGTTCGCCG GCTTTCCCCG TCAAGCTCTA AATCGGGGGC TCCCTTTAGG GTTCCGATTT AGTGCTTTAC GGCACCTCGA CCCCAAAAAA CTTGATTTGG GTGATGGTTC ACGTAGTGGG CCATCGCCCT GATAGACGGT TTTTCGCCCT TTGACGTTGG AGTCCACGTT CTTTAATAGT GGACTCTTGT TCCAAACTGG AACAACACTC AACCCTATCT CGGGCTATTC TTTTGATTTA TAAGGGATTT TGCCGATTTC GGCCTATTGG TTAAAAAATG AGCTGATTTA ACAAAAATTT AACGCGAATT TTAACAAAAT ATTAACGTTT ACAATTTTAT GGTGCACTCT CAGTACAATC TGCTCTGATG CCGCATAGTT AAGCCAGCCC CGACACCCGC CAACACCCGC TGACGCGCCC TGACGGGCTT GTCTGCTCCC GGCATCCGCT TACAGACAAG CTGTGACCGT CAACGGGAGC TGCATGTGTC AGAGGTTTTC ACCGTCATCA CCGAAACGCG CGACCCGAAA GGGCCTCGTG ATACGCCTAT TTTTATAGGT TAATGTCATG ATAATAATGG TTTCTTAGAC GTCAGGTGGC ACTTTTCGGG GAAATGTGCG CGGAACCCCT ATTTGTTTAT TTTTCTAAAT ACATTCAAAT ATGTATCCGC TCATGAGACA ATAACCCTGA TAAATGCTTC AATAATATTG AAAAAGGAAG AGTATGAGTA TTCAACATTT CCGTGTCGCC CTTATTCCCT TTTTTGCGGC ATTTTGCCTT CCTGTTTTTG CTCACCCAGA AACGCTGGTG AAAGTAAAAG ATGCTGAAGA TCAGTTGGGT GCACGAGTGG GTTACATCGA ACTGGATCTC AACAGCGGTA AGATCCTTGA GAGTTTTCGC CCCGAAGAAC GTTTTCCAAT GATGAGCACT TTTAAAGTTC TGCTATGTGG CGCGGTATTA TCCCGTATTG ACGCCGGGCA AGAGCAACTC GGTCGCCGCA TACACTATTC TCAGAATGAC TTGGTTGAGT ACTCACCAGT CACAGAAAAG CATCTTACGG ATGGCATGAC AGTAAGAGAA TTATGCAGTG CTGCCATAAC CATGAGTGAT AACACTGCGG CCAACTTACT TCTGACAACG ATCGGAGGAC CGAAGGAGCT AACCGCTTTT TTGCACAACA TGGGGGATCA TGTAACTCGC CTT

GE100003, scramble sequence in pCas-Guide vector

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_002412
UniProt ID P16455
Synonyms methylguanine-DNA methyltransferase; O-6-methylguanine-DNA methyltransferase; O6-methylguanine-DNA methyltransferase; OTTHUMP00000020741
Summary Alkylating agents are potent carcinogens that can result in cell death, mutation and cancer. The protein encoded by this gene is a DNA repair protein that is involved in cellular defense against mutagenesis and toxicity from alkylating agents. The protein catalyzes transfer of methyl groups from O(6)-alkylguanine and other methylated moieties of the DNA to its own molecule, which repairs the toxic lesions. Methylation of the genes promoter has been associated with several cancer types, including colorectal cancer, lung cancer, lymphoma and glioblastoma. [provided by RefSeq, Sep 2015]

Other Versions

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.