BRD9 (NM_001009877) Human Untagged Clone
CAT#: SC327915
BRD9 (untagged)-Human bromodomain containing 9 (BRD9) transcript variant 2
"NM_001009877" in other vectors (7)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | BRD9 |
Synonyms | LAVS3040; PRO9856 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001009877, the custom clone sequence may differ by one or more nucleotides
ATGATGACAGGTCAGACCATGAGCGAGAGAGGCACAAAGAAAAGAAAAAGAAGAAGAAGAAGAAGTCCGA GAAGGAGAAGCATCTGGACGATGAGGAAAGAAGGAAGCGAAAGGAAGAGAAGAAGCGGAAGCGAGAGAGG GAGCACTGTGACACGGAGGGAGAGGCTGACGACTTTGATCCTGGGAAGAAGGTGGAGGTGGAGCCGCCCC CAGATCGGCCAGTCCGAGCGTGCCGGACACAGCCAGCCGAAAATGAGAGCACACCTATTCAGCAACTCCT GGAACACTTCCTCCGCCAGCTTCAGAGATCCCCATGGATTTTTTGCTTTTCCTGTCACGGATGCAATTGC TCCTGGATATTCAATGATAATAAAACATCCCATGGATTTTGGCACCATGAAAGACAAAATTGTAGCTAAT GAATACAAGTCAGTTACGGAATTTAAGGCAGATTTCAAGCTGATGTGTGATAATGCAATGACATACAATA GGCCAGATACCGTGTACTACAAGTTGGCGAAGAAGATCCTTCACGCAGGCTTTAAGATGATGAGCAAACA GGCAGCTCTTTTGGGCAATGAAGATACAGCTGTTGAGGAACCTGTCCCTGAAGTTGTACCAGTACAAGTA GAAACTGCCAAGAAATCCAAAAAGCCGAGTAGAGAAGTTATCAGCTGCATGTTTGAGCCTGAAGGGAATG CCTGCAGCTTGACGGACAGTACCGCAGAGGAGCACGTGCTGGCGCTGGTGGAGCACGCAGCTGACGAAGC TCGGGACAGGATCAACCGGTTCCTCCCAGGCGGCAAGATGGGCTATCTGAAGAGGAACGGGGACGGGAGC CTGCTCTACAGCGTGGTCAACACGGCCGAGCCGGACGCTGATGAGGAGGAGACCCACCCGGTGGACTTGA GCTCGCTCTCCAGTAAGCTACTCCCAGGCTTCACCACGCTGGGCTTCAAAGACGAGAGAAGAAACAAAGT CACCTTTCTCTCCAGTGCCACTACTGCGCTTTCGATGCAGAATAATTCAGTATTTGGCGACTTGAAGTCG GACGAGATGGAGCTGCTCTACTCAGCCTACGGAGATGAGACAGGCGTGCAGTGTGCGCTGAGCCTGCAGG AGTTTGTGAAGGATGCTGGGAGCTACAGCAAGAAAGTGGTGGACGACCTCCTGGACCAGATCACAGGCGG AGACCACTCTAGGACGCTCTTCCAGCTGAAGCAGAGAAGAAATGTTCCCATGAAGCCTCCAGATGAAGCC AAGGTTGGGGACACCCTAGGAGACAGCAGCAGCTCTGTTCTGGAGTTCATGTCGATGAAGTCCTATCCCG ACGTTTCTGTGGATATCTCCATGCTCAGCTCTCTGGGGAAGGTGAAGAAGGAGCTGGACCCTGACGACAG CCATTTGAACTTGGATGAGACGACGAAGCTCCTGCAGGACCTGCACGAAGCACAGGCGGAGCGCGGCGGC TCTCGGCCGTCGTCCAACCTCAGCTCCCTGTCCAACGCCTCCGAGAGGGACCAGCACCACCTGGGAAGCC CTTCTCGCCTGAGTGTCGGGGAGCAGCCAGACGTCACCCACGACCCCTATGAGTTTCTTCAGTCTCCAGA GCCTGCGGCCTCTGCCAAGACCTAA |
Restriction Sites | Please inquire |
ACCN | NM_001009877 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001009877.2, NP_001009877.2 |
RefSeq Size | 2526 bp |
RefSeq ORF | 2526 bp |
Locus ID | 65980 |
UniProt ID | Q9H8M2 |
Cytogenetics | 5p15.33 |
Gene Summary | Plays a role in chromatin remodeling and regulation of transcription (PubMed:22464331, PubMed:26365797). Acts as a chromatin reader that recognizes and binds acylated histones: binds histones that are acetylated and/or butyrylated (PubMed:26365797). Component of SWI/SNF chromatin remodeling subcomplex GBAF that carries out key enzymatic activities, changing chromatin structure by altering DNA-histone contacts within a nucleosome in an ATP-dependent manner (PubMed:29374058).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (2) has a distinct N-terminus and is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC208315 | BRD9 (Myc-DDK-tagged)-Human bromodomain containing 9 (BRD9), transcript variant 2 |
USD 686.00 |
|
RC208315L1 | Lenti ORF clone of Human bromodomain containing 9 (BRD9), transcript variant 2, Myc-DDK-tagged |
USD 986.00 |
|
RC208315L2 | Lenti ORF clone of Human bromodomain containing 9 (BRD9), transcript variant 2, mGFP tagged |
USD 986.00 |
|
RC208315L3 | Lenti ORF clone of Human bromodomain containing 9 (BRD9), transcript variant 2, Myc-DDK-tagged |
USD 986.00 |
|
RC208315L4 | Lenti ORF clone of Human bromodomain containing 9 (BRD9), transcript variant 2, mGFP tagged |
USD 986.00 |
|
RG208315 | BRD9 (tGFP-tagged) - Human bromodomain containing 9 (BRD9), transcript variant 2 |
USD 886.00 |
|
SC319962 | BRD9 (untagged)-Human bromodomain containing 9 (BRD9), transcript variant 2 |
USD 686.00 |
{0} Product Review(s)
Be the first one to submit a review