Bmp7 (NM_001191856) Rat Untagged Clone

CAT#: RN216650

Bmp7 (untagged) - Rat bone morphogenetic protein 7 (Bmp7)

USD 412.00


Availability*
2 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Bmp7 (NM_001191856) Rat Untagged Clone
Symbol Bmp7
Synonyms BMP-7; BMP-7
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>RN216650 representing NM_001191856
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCACGTGCGCTCGCTGCGCGCTGCGGCGCCACACAGCTTCGTGGCGCTCTGGGCGCCTCTGTTCTTGC
TGCGCTCTGCCTTGGCCGACTTCAGCCTGGACAACGAGGTGCACTCCAGTTTCATCCACCGGCGCCTCCG
CAGTCAGGAGCGGCGGGAGATGCAGCGGGAAATCCTGTCCATCTTGGGCTTGCCCCATCGTCCGCGCCCG
CACCTCCAGGGAAAACATAATTCGGCGCCCATGTTCATGTTGGACCTGTACAACGCCATGGCGGTGGAGG
AGAGTGGGCCGGACGGACAGGGCTTCTCCTACCCCTACAAGGCCGTCTTCAGTACCCAGGGTCCCCCTTT
GGCCAGCCTGCAGGACAGCCACTTCCTCACCGACGCCGACATGGTCATGAGCTTCGTCAACCTAGTGGAG
CACGACAAGGAATTCTTCCACCCTCGATACCACCATCGAGAGTTCCGGTTTGATCTTTCCAAGATCCCCG
AGGGAGAGGCGGTGACCGCAGCCGAGTTCAGGATCTATAAGGACTACATCCGGGAGCGGTTTGACAACGA
GACCTTCCAGATCACAGTCTATCAGGTGCTCCAGGAGCACTCAGGCAGGGAGTCCGACCTCTTCTTGCTG
GACAGCCGTACCATCTGGGCTTCTGAGGAGGGCTGGTTGGTATTTGACATCACAGCCACCAGCAACCACT
GGGTGGTCAACCCTCGGCACAACCTGGGCTTACAGCTCTCCGTGGAGACCCTGGATGGGCAGAGCATCAA
CCCCAAGTTGGCAGGCCTGATTGGACGGCATGGACCCCAGAACAAGCAACCCTTCATGGTGGCCTTCTTC
AAGGCCACGGAGGTTCATCTCCGTAGCATCCGGTCCACGGGGGGCAAACAACGCAGCCAGAACCGCTCCA
AGACTCCAAAGAACCAAGAGGCACTGAGGATGGCCAGTGTGGCAGAAAACAGCAGCAGTGACCAGAGGCA
GGCCTGCAAGAAACACGAGCTGTATGTTAGCTTCCGAGACCTTGGCTGGCAGGACTGGATCATCGCACCT
GAAGGCTATGCTGCCTACTACTGTGAGGGAGAGTGTGCCTTCCCTCTGAACTCCTACATGAACGCCACCA
ACCATGCTATCGTCCAGACACTGGTTCACTTCATCAACCCAGACACCGTACCCAAGCCCTGCTGTGCCCC
CACCCAGCTCAACGCGATATCTGTCCTCTACTTCGACGACAGCTCCAACGTCATCCTGAAGAAGTACAGA
AACATGGTGGTCCGGGCCTGTGGCTGCCACTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001191856
ORF Size 1293 bp
Insert Size 1293
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001191856.2, NP_001178785
RefSeq Size 2448
RefSeq ORF 1293
Locus ID 85272
Cytogenetics 3q42
Gene Summary binds to cell surface heparan sulfate [RGD, Feb 2006]. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.