MIR6740 Human qPCR Template Standard (MI0022585)

CAT#: HK301336

MIR6740 (Human) qSTAR miRNA primer pairs + Copy number standard kit

USD 295.00


Availability*
2 Weeks

Size
    • 200 rxns

Product images

Specifications

Product Data
Forward Sequence AGTTTGGGATGGAGAGAGGA
Reverse Sequence GAACATGTCTGCGTATCTC
Accession No MIMAT0027381
Synonyms MIR6740 hsa-mir-6740,MIMAT0027381,hsa-miR-6740-5p,MI0022585
Components 1 vial of lyophilized SybGREEN qPCR miRNA primer mix (1 nmol each primer, sufficient for 200 reactions), 1 vial lyophilized qPCR miRNA template standard: 50 X 107 copies (100 reactions)
Quality Control Each standard is generated using qSTAR miRNA primer pairs and sequence-verified prior to shipment
Storage & Stability The primer mix and template standard are stable for one year from date of shipping when stored at -20 degrees C
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents