TAL1 (NM_001290404) Human Untagged Clone

CAT#: SC335390

TAL1 (untagged) - Human T-cell acute lymphocytic leukemia 1 (TAL1), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TAL1
• Synonyms: bHLHa17; SCL; tal-1; TCL5
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC335390 representing NM_001290404.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGACCGAGCGGCCGCCGAGCGAGGCGGCTCGCAGTGACCCCCAGCTAGAGGGACGGGACGCGGCCGAG
  GCCAGCATGGCCCCCCCGCACCTGGTCCTGCTGAACGGCGTCGCCAAGGAGACGAGCCGCGCGGCCGCA
  GCGGAGCCCCCAGTCATCGAACTGGGCGCGCGCGGAGGCCCGGGGGGCGGCCCTGCCGGTGGGGGCGGC
  GCCGCGAGAGACTTAAAGGGCCGCGACGCGGCGACGGCCGAAGCGCGCCATCGGGTGCCCACCACCGAG
  CTGTGCAGACCTCCCGGGCCCGCCCCGGCCCCCGCGCCCGCCTCGGTTACAGCGGAGCTGCCCGGCGAC
  GGCCGCATGGTGCAGCTGAGTCCTCCCGCGCTGGCTGCCCCCGCCGCCCCCGGCCGCGCGCTGCTCTAC
  AGCCTCAGCCAGCCGCTGGCCTCTCTCGGCAGCGGGTTCTTTGGGGAGCCGGATGCCTTCCCTATGTTC
  ACCACCAACAATCGAGTGAAGAGGAGACCTTCCCCCTATGAGATGGAGATTACTGATGGTCCCCACACC
  AAAGTTGTGCGGCGTATCTTCACCAACAGCCGGGAGCGATGGCGGCAGCAGAATGTGAACGGGGCCTTT
  GCCGAGCTCCGCAAGCTGATCCCCACACATCCCCCGGACAAGAAGCTCAGCAAGAATGAGATCCTCCGC
  CTGGCCATGAAGTATATCAACTTCTTGGCCAAGCTGCTCAATGACCAGGAGGAGGAGGGCACCCAGCGG
  GCCAAGACTGGCAAGGACCCTGTGGTGGGGGCTGGTGGGGGTGGAGGTGGGGGAGGGGGCGGCGCGCCC
  CCAGATGACCTCCTGCAAGACGTGCTTTCCCCCAACTCCAGCTGCGGCAGCTCCCTGGATGGGGCAGCC
  AGCCCGGACAGCTACACGGAGGAGCCCGCGCCCAAGCACACGGCCCGCAGCCTCCATCCTGCCATGCTG
  CCTGCCGCCGATGGAGCCGGCCCTCGGTGA
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001290404
• Insert Size: 996 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001290404.1
• RefSeq Size: 4779 bp
• RefSeq ORF: 996 bp
• Locus ID: 6886
• UniProt ID: P17542
• Cytogenetics: 1p33
• Protein Families: Adult stem cells, Druggable Genome, ES Cell Differentiation/IPS, Transcription Factors
• MW: 34.3 kDa
• Gene Summary: Implicated in the genesis of hemopoietic malignancies. It may play an important role in hemopoietic differentiation. Serves as a positive regulator of erythroid differentiation (By similarity).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (4) differs in the 5' UTR, compared to variant 1. Variants 1, 2, 3, 4 and 5 encode the same isoform 1. Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.