GLS2 (NM_001280796) Human Untagged Clone

CAT#: SC335352

GLS2 (untagged) - Human glutaminase 2 (liver, mitochondrial) (GLS2), transcript variant 3


  "NM_001280796" in other vectors (2)

Reconstitution Protocol

USD 330.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
GLS2 mouse monoclonal antibody,clone OTI4C10
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "GLS2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GLS2
Synonyms GA; GLS; hLGA; LGA
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335352 representing NM_001280796.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAATACATGGGTTTCAGCAATGCCACGGAAGGTAATTTTTCCCCTTCTCCCAACACCCACTCCTCCA
ACTTCAAGTACTAAATTGGGTGTTTGCTTCAGATTCCAGTCAGAGAAGGAAACAGGGGATCGGAATTAT
GCCATCGGCTATTATCTCAAGGAAAAGAAGTGCTTTCCTAAGGGGGTGGACATGATGGCTGCCCTTGAT
CTCTACTTCCAGCTGTGTTCTGTGGAGGTCACTTGTGAATCAGGCAGTGTCATGGCAGCCACCCTCGCC
AACGGTGGGATCTGCCCCATCACAGGCGAGAGTGTGCTGAGTGCTGAAGCAGTGCGCAACACCCTCAGC
CTCATGCATTCCTGCGGCATGTATGACTTCTCTGGCCAGTTTGCCTTCCACGTGGGCCTGCCAGCCAAG
TCAGCTGTATCAGGAGCCATCCTCCTGGTGGTACCCAATGTCATGGGAATGATGTGCCTGTCACCCCCA
TTGGACAAGCTGGGGAACAGCCATAGGGGGACCAGCTTCTGCCAGAAGTTGGTGTCTCTCTTCAATTTC
CACAACTATGACAACCTGAGGCACTGTGCTCGGAAGTTAGACCCACGGCGTGAAGGGGCAGAAATTCGG
AACAAGACTGTGGTCAACCTGTTATTTGCTGCCTATAGTGGCGATGTCTCAGCTCTTCGAAGGTTTGCC
TTGTCAGCCATGGATATGGAACAGAAAGACTATGACTCGCGCACAGCTCTGCATGTTGCTGCAGCTGAA
GGACACATCGAAGTTGTTAAATTCCTGATCGAGGCTTGCAAAGTGAATCCTTTTGCCAAGGACAGGTGG
GGCAACATTCCCCTGGATGATGCTGTGCAGTTCAACCATCTGGAGGTGGTCAAACTGCTTCAAGATTAC
CAGGACTCCTACACACTCTCTGAAACTCAGGCTGAGGCAGCAGCTGAGGCCCTGTCCAAAGAGAACTTA
GAAAGCATGGTATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001280796
Insert Size 981 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001280796.1
RefSeq Size 2721 bp
RefSeq ORF 981 bp
Locus ID 27165
Cytogenetics 12q13.3
Protein Pathways Alanine, aspartate and glutamate metabolism, Arginine and proline metabolism, D-Glutamine and D-glutamate metabolism, Metabolic pathways, Nitrogen metabolism
MW 35.9 kDa
Gene Summary The protein encoded by this gene is a mitochondrial phosphate-activated glutaminase that catalyzes the hydrolysis of glutamine to stoichiometric amounts of glutamate and ammonia. Originally thought to be liver-specific, this protein has been found in other tissues as well. Alternative splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (3) differs in the 5' UTR and 5' coding region, uses an alternate start codon, and uses an alternate in-frame splice site in the 5' coding region compared to variant 1. It encodes isoform 3 which has a distinct and shorter N-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.