B3GAT3 (NM_001288723) Human Untagged Clone

CAT#: SC335287

B3GAT3 (untagged) - Human beta-1,3-glucuronyltransferase 3 (B3GAT3), transcript variant 4


  "NM_001288723" in other vectors (2)

Reconstitution Protocol

USD 330.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


Rabbit Polyclonal Anti-B3GAT3 Antibody
    • 100 ul

USD 539.00

Other products for "B3GAT3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol B3GAT3
Synonyms GLCATI; glcUAT-I; JDSCD
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335287 representing NM_001288723.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAAGCTGAAGCTGAAGAACGTGTTTCTCGCCTACTTCCTGGTGTCGATCGCCGGCCTCCTCTACGCG
CTGGTACAGCTCGGCCAGCCATGTGACTGCCTTCCTCCCCTGCGGGCAGCAGCCGAGCAGCTACGGCAG
AAGGATCTGAGGATTTCCCAGCTGCAAGCGGAACTCCGACGGCCACCCCCTGCCCCTGCCCAGCCCCCT
GAACCCGAGGCCCTGCCTACTATCTATGTTGTTACCCCCACCTATGCCAGGCTGGTACAGAAGGCAGAG
CTGGTACGACTGTCCCAGACACTGAGCCTGGTGCCCCGGCTGCATTGGCTGCTGGTGGAGGATGCTGAG
GGTCCCACCCCGCTGGTCTCAGGGCTGCTGGCTGCCTCTGGCCTCCTCTTCACACACCTGGTGGTCCTC
ACGCCCAAAGCCCAGCGGCTTCGGGAGGGCGAGCCTGGCTGGGTTCATCCCCGTGGTGTCGAGCAGCGG
AACAAGGCCCTGGACTGGCTCCGGGGCAGAGGGGGTGCTGTGGGTGGGGAGAAGGACCCACCACCACCA
GGGACCCAAGGAGTCGTCTACTTTGCTGACGATGACAACACCTACAGCCGGGAGCTGTTTGAGGAGATG
CGCTGGACCCGTGGTGTCTCAGTGTGGCCTGTGGGGCTGGTGGGCGGCCTGCGATTCGAGGGCCCTCAG
GTACAGGACGGCCGGGTAGTGGGCTTCCACACAGCATGGGAGCCCAGCAGGCCCTTCCCTGTGGATATG
GCTGGATTTGCCGTGGCCCTGCCCTTGCTGTTAGATAAGCCCAATGCCCAATTTGATTCCACCGCTCCC
CGGGGCCACCTGGAGAGCAGTCTTCTGAGCCACCTTGTGGATCCCAAGGACCTGGAGCCACGGGCTGCC
AACTGCACTCGGACAGAGTCTCGCTGTGTCACCCAGGCTGGAGTGCAGTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001288723
Insert Size 948 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001288723.1
RefSeq Size 2098 bp
RefSeq ORF 948 bp
Locus ID 26229
UniProt ID O94766
Cytogenetics 11q12.3
Protein Families Transmembrane
Protein Pathways Chondroitin sulfate biosynthesis, Heparan sulfate biosynthesis, Metabolic pathways
MW 34.6 kDa
Gene Summary The protein encoded by this gene is a member of the glucuronyltransferase gene family, enzymes that exhibit strict acceptor specificity, recognizing nonreducing terminal sugars and their anomeric linkages. This gene product catalyzes the formation of the glycosaminoglycan-protein linkage by way of a glucuronyl transfer reaction in the final step of the biosynthesis of the linkage region of proteoglycans. A pseudogene of this gene has been identified on chromosome 3. [provided by RefSeq, Dec 2013]
Transcript Variant: This variant (4) uses an alternate splice site in its 3' coding region, compared to variant 1. The encoded isoform (4) has a shorter and distinct C-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.