Caspase-7 (CASP7) (NM_001267057) Human Untagged Clone

CAT#: SC332840

CASP7 (untagged) - Homo sapiens caspase 7, apoptosis-related cysteine peptidase (CASP7), transcript variant f

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: Caspase-7
• Synonyms: CASP-7; CMH-1; ICE-LAP3; LICE2; MCH3
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC332840 representing NM_001267057.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGCGTGCGGGGACACGGGTCGCTTTGGGCTCTTCCACCCCTGCGGAGCGCACTACCCCGAGCCAGGGG
  CGGTGCAAGCCCCGCCCGGCCCTACCCAGGGCGGCTCCTCCCTCCGCAGCGCCGAGACTTTTAGTTTCG
  CTTTCGCTAAAGGGGCCCCAGACCCTTGCTGCGGAGCGACGGAGAGAGACTGTGCCAGTCCCAGCCGCC
  CTACCGCCGTGGGAACGATGGCAGATGATCAGGGCTGTATTGAAGAGCAGGGGGTTGAGGATTCAGCAA
  ATGAAGATTCAGTGGATGCTAAGCCAGACCGGTCCTCGTTTGTACCGTCCCTCTTCAGCCCCTGACTCT
  GGAACTTTATATTTCACCAGTAAGAAGAAGAAAAATGTCACCATGCGATCCATCAAGACCACCCGGGAC
  CGAGTGCCTACATATCAGTACAACATGAATTTTGAAAAGCTGGGCAAATGCATCATAATAAACAACAAG
  AACTTTGATAAAGTGACAGGTATGGGCGTTCGAAACGGAACAGACAAAGATGCCGAGGCGCTCTTCAAG
  TGCTTCCGAAGCCTGGGTTTTGACGTGATTGTCTATAATGACTGCTCTTGTGCCAAGATGCAAGATCTG
  CTTAAAAAAGCTTCTGAAGAGGACCATACAAATGCCGCCTGCTTCGCCTGCATCCTCTTAAGCCATGGA
  GAAGAAAATGTAATTTATGGGAAAGATGGTGTCACACCAATAAAGGATTTGACAGCCCACTTTAGGGGG
  GATAGATGCAAAACCCTTTTAGAGAAACCCAAACTCTTCTTCATTCAGGCTTGCCGAGGGACCGAGCTT
  GATGATGGCATCCAGGCCGACTCGGGGCCCATCAATGACACAGATGCTAATCCTCGATACAAGATCCCA
  GTGGAAGCTGACTTCCTCTTCGCCTATTCCACGGTTCCAGGCTATTACTCGTGGAGGAGCCCAGGAAGA
  GGCTCCTGGTTTGTGCAAGCCCTCTGCTCCATCCTGGAGGAGCACGGAAAAGACCTGGAAATCATGCAG
  ATCCTCACCAGGGTGAATGACAGAGTTGCCAGGCACTTTGAGTCTCAGTCTGATGACCCACACTTCCAT
  GAGAAGAAGCAGATCCCCTGTGTGGTCTCCATGCTCACCAAGGAACTCTACTTCAGTCAATAG
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001267057
• Insert Size: 1167 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001267057.1
• RefSeq Size: 2638 bp
• RefSeq ORF: 1167 bp
• Locus ID: 840
• UniProt ID: P55210
• Cytogenetics: 10q25.3
• Protein Families: Druggable Genome, Protease
• Protein Pathways: Alzheimer's disease, Apoptosis
• MW: 43.7 kDa
• Gene Summary: This gene encodes a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce two subunits, large and small, that dimerize to form the active enzyme. The precursor of the encoded protein is cleaved by caspase 3 and 10, is activated upon cell death stimuli and induces apoptosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012]
  Transcript Variant: This variant (f) lacks an internal exon in the 5' region and initiates translation at an alternate upstream start codon, compared to variant d. The encoded isoform (e) is longer and has a distinct N-terminus, compared to isoform delta. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.