GNPDA2 (NM_001270881) Human Untagged Clone
CAT#: SC330882
GNPDA2 (untagged) - Homo sapiens glucosamine-6-phosphate deaminase 2 (GNPDA2), transcript variant 3
"NM_001270881" in other vectors (2)
Product Images
Frequently bought together (4)
Other products for "GNPDA2"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | GNPDA2 |
Synonyms | GNP2; SB52 |
Vector | pCMV6-Entry |
Sequence Data |
>SC330882 representing NM_001270881.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGATGAATATGTAGGACTTCCAAGAAATCATCCTGAAAGCTACCATTCTTATATGTGGAATAATTTT TTTAAGCATATCGATATAGATCCTAATAATGCACATATCCTTGACGGGAATGCTGCAGATTTACAAGCA GAATGTGATGCTTTTGAAAACAAAATAAAAGAAGCTGGAGGAATAGATCTTTTTGTTGGAGGAATTGGT CCAGATGGTCATATCGCTTTCAATGAGCCTGGATCCAGTTTAGTGTCAAGGACAAGATTAAAGACTCTA GCAATGGATACCATCTTGGCAAATGCCAAATATTTTGATGGAGATTTATCAAAAGTGCCAACTATGGCT CTAACTGTTGGTGTGGGGACAGTGATGGATGCTAGAGAAGTAATGATCCTTATAACAGGGGCACACAAG GCATTTGCCCTGTACAAAGCAATAGAAGAAGGAGTCAATCACATGTGGACTGTTTCCGCTTTCCAGCAG CATCCCCGGACTATTTTTGTATGCGATGAAGATGCTACTTTAGAATTAAGAGTTAAAACTGTGAAATAC TTTAAAGGTCTAATGCATGTGCACAATAAACTTGTGGATCCACTATTCAGTATGAAAGATGGAAACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001270881 |
Insert Size | 621 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001270881.1 |
RefSeq Size | 2154 bp |
RefSeq ORF | 621 bp |
Locus ID | 132789 |
UniProt ID | Q8TDQ7 |
Cytogenetics | 4p12 |
Protein Pathways | Amino sugar and nucleotide sugar metabolism, Metabolic pathways |
MW | 22.9 kDa |
Gene Summary | The protein encoded by this gene is an allosteric enzyme that catalyzes the reversible reaction converting D-glucosamine-6-phosphate into D-fructose-6-phosphate and ammonium. Variations of this gene have been reported to be associated with influencing body mass index and susceptibility to obesity. A pseudogene of this gene is located on chromosome 9. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Aug 2012] Transcript Variant: This variant (3) lacks an alternate exon in the 5' UTR and uses a downstream start codon compared to variant 1. It encodes isoform 3 which has a shorter N-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.