GNPDA2 (NM_001270881) Human Untagged Clone

CAT#: SC330882

GNPDA2 (untagged) - Homo sapiens glucosamine-6-phosphate deaminase 2 (GNPDA2), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GNPDA2
• Synonyms: GNP2; SB52
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC330882 representing NM_001270881.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGGATGAATATGTAGGACTTCCAAGAAATCATCCTGAAAGCTACCATTCTTATATGTGGAATAATTTT
  TTTAAGCATATCGATATAGATCCTAATAATGCACATATCCTTGACGGGAATGCTGCAGATTTACAAGCA
  GAATGTGATGCTTTTGAAAACAAAATAAAAGAAGCTGGAGGAATAGATCTTTTTGTTGGAGGAATTGGT
  CCAGATGGTCATATCGCTTTCAATGAGCCTGGATCCAGTTTAGTGTCAAGGACAAGATTAAAGACTCTA
  GCAATGGATACCATCTTGGCAAATGCCAAATATTTTGATGGAGATTTATCAAAAGTGCCAACTATGGCT
  CTAACTGTTGGTGTGGGGACAGTGATGGATGCTAGAGAAGTAATGATCCTTATAACAGGGGCACACAAG
  GCATTTGCCCTGTACAAAGCAATAGAAGAAGGAGTCAATCACATGTGGACTGTTTCCGCTTTCCAGCAG
  CATCCCCGGACTATTTTTGTATGCGATGAAGATGCTACTTTAGAATTAAGAGTTAAAACTGTGAAATAC
  TTTAAAGGTCTAATGCATGTGCACAATAAACTTGTGGATCCACTATTCAGTATGAAAGATGGAAACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001270881
• Insert Size: 621 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001270881.1
• RefSeq Size: 2154 bp
• RefSeq ORF: 621 bp
• Locus ID: 132789
• UniProt ID: Q8TDQ7
• Cytogenetics: 4p12
• Protein Pathways: Amino sugar and nucleotide sugar metabolism, Metabolic pathways
• MW: 22.9 kDa
• Gene Summary: The protein encoded by this gene is an allosteric enzyme that catalyzes the reversible reaction converting D-glucosamine-6-phosphate into D-fructose-6-phosphate and ammonium. Variations of this gene have been reported to be associated with influencing body mass index and susceptibility to obesity. A pseudogene of this gene is located on chromosome 9. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Aug 2012]
  Transcript Variant: This variant (3) lacks an alternate exon in the 5' UTR and uses a downstream start codon compared to variant 1. It encodes isoform 3 which has a shorter N-terminus compared to isoform 1.