GATA2(GATA2) (NM_032638) Human Untagged Clone

CAT#: SC321007

GATA2 (untagged)-Human GATA binding protein 2 (GATA2), transcript variant 2

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name GATA2(GATA2) (NM_032638) Human Untagged Clone
Symbol GATA2
Synonyms DCML; IMD21; MONOMAC; NFE1B
Vector pCMV6-AC
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_032638.3 GAGCGCCAGGAAGGTAGCGAGGCCAGCGTCGCCCCGGGACTCGCTGCTCAAGTCTGTCTA
TTGCCTGCCGCCACATCCATCCTAGCAGGGCCCCGTCGCCCACCAGGCGGACAAAAGCGG
TCCGCTGAACACCATGCGGCCGCTCGGCGTGCCGCCCAGGCTCTGCTGGTGAGCGCCGCC
ACCCCGCGCCCAGGTCCCGCGAGCCCGCCTGCCGCGCACCTCGCCCTGCTCCCAGCTCTA
CTCCAGGCCCCGTCCGCCCGGGGGCGCCGCCCACCGCGCCTCGCTCGGGCCGTTGCCGTC
TGCACCCAGACCCTGAGCCGCCGCCGCCGGCCATGGAGGTGGCGCCGGAGCAGCCGCGCT
GGATGGCGCACCCGGCCGTGCTGAATGCGCAGCACCCCGACTCACACCACCCGGGCCTGG
CGCACAACTACATGGAACCCGCGCAGCTGCTGCCTCCAGACGAGGTGGACGTCTTCTTCA
ATCACCTCGACTCGCAGGGCAACCCCTACTATGCCAACCCCGCTCACGCGCGGGCGCGCG
TCTCCTACAGCCCCGCGCACGCCCGCCTGACCGGAGGCCAGATGTGCCGCCCACACTTGT
TGCACAGCCCGGGTTTGCCCTGGCTGGACGGGGGCAAAGCAGCCCTCTCTGCCGCTGCGG
CCCACCACCACAACCCCTGGACCGTGAGCCCCTTCTCCAAGACGCCACTGCACCCCTCAG
CTGCTGGAGGCCCTGGAGGCCCACTCTCTGTGTACCCAGGGGCTGGGGGTGGGAGCGGGG
GAGGCAGCGGGAGCTCAGTGGCCTCCCTCACCCCTACAGCAGCCCACTCTGGCTCCCACC
TTTTCGGCTTCCCACCCACGCCACCCAAAGAAGTGTCTCCTGACCCTAGCACCACGGGGG
CTGCGTCTCCAGCCTCATCTTCCGCGGGGGGTAGTGCAGCCCGAGGAGAGGACAAGGACG
GCGTCAAGTACCAGGTGTCACTGACGGAGAGCATGAAGATGGAAAGTGGCAGTCCCCTGC
GCCCAGGCCTAGCTACTATGGGCACCCAGCCTGCTACACACCACCCCATCCCCACCTACC
CCTCCTATGTGCCGGCGGCTGCCCACGACTACAGCAGCGGACTCTTCCACCCCGGAGGCT
TCCTGGGGGGACCGGCCTCCAGCTTCACCCCTAAGCAGCGCAGCAAGGCTCGTTCCTGTT
CAGAAGGCCGGGAGTGTGTCAACTGTGGGGCCACAGCCACCCCTCTCTGGCGGCGGGACG
GCACCGGCCACTACCTGTGCAATGCCTGTGGCCTCTACCACAAGATGAATGGGCAGAACC
GACCACTCATCAAGCCCAAGCGAAGACTGTCGGCCGCCAGAAGAGCCGGCACCTGTTGTG
CAAATTGTCAGACGACAACCACCACCTTATGGCGCCGAAACGCCAACGGGGACCCTGTCT
GCAACGCCTGTGGCCTCTACTACAAGCTGCACAATGTTAACAGGCCACTGACCATGAAGA
AGGAAGGGATCCAGACTCGGAACCGGAAGATGTCCAACAAGTCCAAGAAGAGCAAGAAAG
GGGCGGAGTGCTTCGAGGAGCTGTCAAAGTGCATGCAGGAGAAGTCATCCCCCTTCAGTG
CAGCTGCCCTGGCTGGACACATGGCACCTGTGGGCCACCTCCCGCCCTTCAGCCACTCCG
GACACATCCTGCCCACTCCGACGCCCATCCACCCCTCCTCCAGCCTCTCCTTCGGCCACC
CCCACCCGTCCAGCATGGTGACCGCCATGGGCTAGGGAACAGATGGACGTCGAGGACCGG
GCACTCCCGGGATGGGTGGACCAAACCCTTAGCAGCCCAGCATTTCCCGAAGGCCGACAC
CACTCCTGCCAGCCCGGCTCGGCCCAGCACCCCCTCTCCTGGAGGGCGCCCAGCAGCCTG
CCAGCAGTTACTGTGAATGTTCCCCACCGCTGAGAGGCTGCCTCCGCACCTGACTGCTGC
CCAGGTGGGGTTTCCTGCATGGACAGTTGTTTGGAGAACAACAAGGACAACTTTATGTAG
AGAAAAGGAGGGGACGGGACAGACGAAGGCAACCATTTTTAGAAGGAAAAAGGATTAGGC
AAAAATAATTTATTTTGCTCTTGTTTCTAACAAGGACTTGGAGACTTGGTGGTCTGAGCT
GTCCCAAGTCCTCCGGTTCTTCCTCGGGATTGGCGGGTCCACTTGCCAGGGCTCTGGGGG
CAGATTTGTGGGGACCTCAGCCTGCACCCTCTTCTCTTCTGGCTTCCCTCTCTGAAATAG
CCGAACTCCAGGCTGGGCTGAGCCAAAGCCAGAGTGGCCACGGCCCAGGGAGGGTGAGCT
GGTGCCTGCTTTGACGGGCCAGGCCCTGGAGGGCAGAGACAATCACGGGCGGTCCTGCAC
AGATTCCCAGGCCAGGGCTGGGTCACAGGAAGGAAACAACATTTTCTTGAAAGGGGAAAC
GTCTCCCAGATCGCTCCCTTGGCTTTGAGGCCGAAGCTGCTGTGACTGTGTCCCCTTACT
GAGCGCAAGCCACAGCCTGTCTTGTCAGGTGGACCCTGTAAATACATCCTTTTTCTGCTA
ACCCTTCAACCCCCTCGCCTCCTACTCTGAGACAAAAGAAAAAATATTAAAAAAATGCAT
AGGCTTAACTCGCTGATGAGTTAATTGTTTTATTTTTAAACTCTTTTTGGGTCCAGTTGA
TTGTACGTAGCCACAGGAGCCCTGCTATGAAAGGAATAAAACCTACACACAAGGTTGGAG
CTTTGCAATTCTTTTTGGAAAAGAGCTGGGATCCCACAGCCCTAGTATGAAAGCTGGGGG
TGGGGAGGGGCCTTTGCTGCCCTTGGTTTCTGGGGGCTGGTTGGCATTTGCTGGCCTGGC
AGGGGGTGAAGGCAGGAGTTGGGGGCAGGTCAGGACCAGGACCCAGGGAGAGGCTGTGTC
CCTGCTGGGGTCTCAGGTCCAGCTTTACTGTGGCTGTCTGGATCCTTCCCAAGGTACAGC
TGTATATAAACGTGTCCCGAGCTTAGATTCTGTATGCGGTGACGGCGGGGTGTGGTGGCC
TGTGAGGGGCCCCTGGCCCAGGAGGAGGATTGTGCTGATGTAGTGACCAAGTGCAATATG
GGCGGGCAGTCGCTGCAGGGAGCACCACGGCCAGAAGTAACTTATTTTGTACTAGTGTCC
GCATAAGAAAAAGAATCGGCAGTATTTTCTGTTTTTATGTTTTATTTGGCTTGTTTTATT
TTGGATTAGTGAACTAAGTTATTGTTAATTATGTACAACATTTATATATTGTCTGTAAAA
AATGTATGCTATCCTCTTATTCCTTTAAAGTGAGTACTGTTAAGAATAATAAAATACTTT
TTGTGAAAAAAAAAAAAAAAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_032638.3 unedited
GCGATTGTATACGACTCCTATAGGGCGGCCGGGAATTCGGCACGAGGGAGCGCCAGGAAG
GTAGCGAGGCCAGCGTCGCCCCGGGACTCGCTGCTCAAGTCTGTCTATTGCCTGCCGCCA
CATCCATCCTAGCAGGGCCCCGTCGCCCACCAGGCGGACAAAAGCGGTCCGCTGAACACC
ATGCGGCCGCTCGGCGTGCCGCCCAGGCTCTGCTGGTGAGCGCCGCCACCCCGCGCCCAG
GTCCCGCGAGCCCGCCTGCCGCGCACCTCGCCCTGCTCCCAGCTCTACTCCAGGCCCCGT
CCGCCCGGGGGCGCCGCCCACCGCGCCTCGCTCGGGCCGTTGCCGTCTGCACCCAGACCC
TGAGCCGCCGCCGCCGGCCATGGAGGTGGCGCCGGAGCAGCCGCGCTGGATGGCGCACCC
GGCCGTGCTGAATGCGCAGCACCCCGACTCACACCACCCGGGCCTGGCGCACAACTACAT
GGAACCCGCGCAGCTGCTGCCTCCAGACGAGGTGGACGTCTTCTTCAATCACCTCGACTC
GCAGGGCAACCCCTACTATGCCAACCCCGCTCACGCGCGGGCGCGCGTCTCCTACAGCCC
CGCGCACGCCCGCCTGACCGGAGGCCAGATGTGCCGCCCACACTTGTTGCACAGCCCGGG
TTTGCCCTGGCTGGACGGGGCAAAGCAGCCCTCTCTGCCGCTGCGGCCCACCACCACAAC
CCCTGGACCGTGAGCCCCTTCTCCAAGACGCCACTGCACCCCTCACTGCTGGAGGCCCTG
GAAGCCCACTCTCTGTGTACCAGGGCTGGGGTGGAGCGGGGGAGGCAGCGAGCTATGGCC
CTCCCTCACCTTACAGACCCCACTCTGCCTCCACACTTTTCGGCTTCCACTCGCCCACAA
ACTGATCATGACCTAGCATCATAGGGGCTGCCTCTCGCCTATTCTTCACGGGAGGTATAG
G
Restriction Sites Please inquire     
Tag Tag Free
ACCN NM_032638
ORF Size 1443 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_032638.3, NP_116027
RefSeq Size 3383
Locus ID 2624
Cytogenetics 3q21.3
Domains GATA
Protein Families ES Cell Differentiation/IPS, Adult stem cells, Transcription Factors, Druggable Genome
Gene Summary This gene encodes a member of the GATA family of zinc-finger transcription factors that are named for the consensus nucleotide sequence they bind in the promoter regions of target genes. The encoded protein plays an essential role in regulating transcription of genes involved in the development and proliferation of hematopoietic and endocrine cell lineages. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Mar 2009].
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations