MXI1 (NM_130439) Human Untagged Clone
CAT#: SC317433
MXI1 (untagged)-Human MAX interactor 1 (MXI1), transcript variant 2
"NM_130439" in other vectors (5)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MXI1 |
Synonyms | bHLHc11; MAD2; MXD2; MXI |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_130439 edited
ATGGGCAAACGCGGGCGGCCGCGCAAGGAGGCGCGCTGCGAGGGCGCGGGGCTGGCCCCC GCCGCGCCCCCGGCTGTGCCCCGCGCCGTGGCCGCGCCCCAGCCCCCGGCCCTGCCCGAG GACCCCGCTGGGGCCAAGCCCAGGTGCCCCTTCTCAGACATTTTCAACACCAGCGAGAAC TCGATGGAGAAGCACATCAACACTTTTCTGCAGAACGTGCAGATTCTGCTCGAGGCCGCC AGCTACCTGGAGCAGATCGAGAAAGAAAACAAAAAGTGTGAACATGGCTACGCCTCTTCA TTCCCGTCCATGCCGAGCCCCCGACTGCAGCATTCAAAGCCCCCACGGAGGTTGAGCCGG GCACAGAAACACAGCAGCGGGAGCAGCAACACCAGCACTGCCAACAGATCTACACACAAT GAGCTGGAAAAGAATCGACGAGCTCATCTGCGCCTTTGTTTAGAACGCTTAAAAGTTCTG ATTCCACTAGGACCAGACTGCACCCGGCACACAACACTTGGTTTGCTCAACAAAGCCAAA GCACACATCAAGAAACTTGAAGAAGCTGAAAGAAAAAGCCAGCACCAGCTCGAGAATTTG GAACGAGAACAGAGATTTTTAAAGTGGCGACTGGAACAGCTGCAGGGTCCTCAGGAGATG GAACGAATACGAATGGACAGCATTGGATCAACTATTTCTTCAGATCGTTCTGATTCAGAG CGAGAGGAGATTGAAGTGGATGTTGAAAGCACAGAGTTCTCCCATGGAGAAGTGGACAAT ATAAGTACCACCAGCATCAGTGACATTGATGACCACAGCAGCCTGCCGAGTATTGGGAGT GACGAGGGTTACTCCAGTGCCAGTGTCAAACTTTCATTCACTTCATAG |
Restriction Sites | Please inquire |
ACCN | NM_130439 |
Insert Size | 2700 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to contain one SNP compared with NM_130439.3. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_130439.3, NP_569157.2 |
RefSeq Size | 3470 bp |
RefSeq ORF | 888 bp |
Locus ID | 4601 |
UniProt ID | P50539 |
Cytogenetics | 10q25.2 |
Domains | HLH |
Protein Families | Druggable Genome, Transcription Factors |
Gene Summary | Expression of the c-myc gene, which produces an oncogenic transcription factor, is tightly regulated in normal cells but is frequently deregulated in human cancers. The protein encoded by this gene is a transcriptional repressor thought to negatively regulate MYC function, and is therefore a potential tumor suppressor. This protein inhibits the transcriptional activity of MYC by competing for MAX, another basic helix-loop-helix protein that binds to MYC and is required for its function. Defects in this gene are frequently found in patients with prostate tumors. Three alternatively spliced transcripts encoding different isoforms have been described. Additional alternatively spliced transcripts may exist but the products of these transcripts have not been verified experimentally. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2), also referred to as SRalpha, differs in the 5' UTR and coding region, compared to variant 1. The resulting protein (isoform b) is longer and has a distinct N-terminus, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC207319 | MXI1 (Myc-DDK-tagged)-Human MAX interactor 1 (MXI1), transcript variant 2 |
USD 300.00 |
|
RC207319L3 | Lenti ORF clone of Human MAX interactor 1 (MXI1), transcript variant 2, Myc-DDK-tagged |
USD 600.00 |
|
RC207319L4 | Lenti ORF clone of Human MAX interactor 1 (MXI1), transcript variant 2, mGFP tagged |
USD 600.00 |
|
RG207319 | MXI1 (tGFP-tagged) - Human MAX interactor 1 (MXI1), transcript variant 2 |
USD 500.00 |
|
SC109464 | MXI1 (untagged)-Human MAX interactor 1 (MXI1), transcript variant 2 |
USD 300.00 |
{0} Product Review(s)
Be the first one to submit a review