C5orf19 (REEP2) (NM_016606) Human Untagged Clone

CAT#: SC317358

REEP2 (untagged)-Human receptor accessory protein 2 (REEP2)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: C5orf19
• Synonyms: C5orf19; SGC32445; SPG72; Yip2d
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC317358 representing NM_016606.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGTGTCCTGGATCATCTCTCGCCTGGTGGTGCTCATCTTTGGCACCCTGTACCCAGCCTATTCTTCC
  TACAAGGCCGTGAAGACAAAAAACGTGAAGGAATATGTGAAATGGATGATGTACTGGATCGTCTTTGCC
  TTCTTCACCACGGCCGAGACGCTCACGGATATAGTGCTCTCCTGGTTCCCCTTCTACTTTGAACTGAAG
  ATCGCCTTCGTGATATGGCTGCTGTCCCCTTACACCAAGGGCTCCAGCGTGCTCTACCGCAAGTTCGTG
  CACCCAACGCTGTCCAACAAGGAGAAGGAGATCGACGAGTACATCACGCAGGCCCGAGACAAGAGCTAT
  GAGACCATGATGAGGGTGGGCAAGAGGGGCCTGAACCTTGCCGCCAATGCTGCAGTCACAGCTGCCGCC
  AAGGGGGTGCTGTCAGAGAAGCTCCGCAGCTTCAGCATGCAGGACCTGACCCTGATCCGGGACGAGGAC
  GCACTGCCCCTGCAGAGGCCTGACGGCCGCCTCCGACCCAGCCCTGGCAGCCTCCTGGACACCATCGAG
  GACTTAGGAGATGACCCTGCCCTGAGTCTAAGGTCCAGCACAAACCCGGCAGATTCCCGGACAGAGGCT
  TCTGAGGATGACATGGGAGACAAAGCTCCCAAGAGGGCCAAACCCATCAAAAAAGCGCCCAAAGCTGAG
  CCACTGGCTTCCAAGACACTGAAGACCCGGCCCAAGAAGAAGACCTCTGGCGGGGGCGACTCAGCTTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_016606
• Insert Size: 759 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_016606.3
• RefSeq Size: 2203 bp
• RefSeq ORF: 759 bp
• Locus ID: 51308
• UniProt ID: Q9BRK0
• Cytogenetics: 5q31.2
• Protein Families: Druggable Genome, Transmembrane
• MW: 28.3 kDa
• Gene Summary: This gene encodes a member of the receptor expression enhancing protein family. Studies of a related gene in mouse suggest that the encoded protein is found in the cell membrane and enhances the function of sweet taste receptors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
  Transcript Variant: This variant (2) uses an alternate in-frame splice site in the coding region, compared to variant 1. The encoded isoform (2) is shorter, compared to isoform 1.