BOULE (BOLL) (NM_197970) Human Untagged Clone

CAT#: SC307621

BOLL (untagged)-Human bol, boule-like (Drosophila) (BOLL), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: BOULE
• Synonyms: BOULE
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC307621 representing NM_197970.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGAAACCGAGTCCGGGCCGCAAACATCAAACCAGATGCAAACAGATTCATTATCTCCATCCCCTAAT
  CCTGTGTCACCTGTGCCTTTGAATAACCCAACAAGTGCCCCAAGATATGGAACAGTGATCCCTAATCGC
  ATCTTTGTAGGAGGAATTGATTTTAAGACAAACGAAAGTGATTTAAGAAAATTTTTTTCCCAGTATGGG
  TCTGTGAAAGAAGTGAAGATTGTAAATGACAGAGCTGGAGTATCCAAAGGGTATGGTTTCGTCACTTTT
  GAAACACAAGAAGATGCACAAAAAATTTTACAAGAGGCTGAAAAACTTAATTATAAGGATAAGAAGCTG
  AACATTGGTCCAGCAATAAGAAAACAACAAGTAGGGATCCCTCGTTCTAGTATAATGCCAGCAGCTGGA
  ACAATGTATCTAACAACTTCAACTGGATATCCTTATACTTACCATAATGGTGTTGCTTATTTTCATACT
  CCAGAGGTAACTTCGGTCCCACCGCCTTGGCCTTCACGTTCTGTATGTAGCTCCCCTGTGATGGTAGCT
  CAGCCCATTTATCAGCAACCTGCATATCACTACCAGGCCACCACACAGTATTTACCAGGACAGTGGCAG
  TGGAGTGTTCCTCAGCCTTCTGCCTCTTCTGCTCCATTCTTATACCTGCAACCTTCTGAGGTTATTTAT
  CAACCAGTGGAAATTGCACAGGATGGTGGATGTGTTCCTCCTCCACTGTCTCTGATGGAAACTTCAGTT
  CCAGAGCCTTATTCTGATCATGGAGTTCAAGCAACATATCACCAGGTTTATGCTCCAAGTGCCATCACT
  ATGCCTGCGCCTGTGATGCAGCCTGAGCCAATTAAAACAGTGTGGAGCATTCATTATTAA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_197970
• Insert Size: 888 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_197970.2
• RefSeq Size: 2779 bp
• RefSeq ORF: 888 bp
• Locus ID: 66037
• UniProt ID: Q8N9W6
• Cytogenetics: 2q33.1
• MW: 32.6 kDa
• Gene Summary: This gene belongs to the DAZ gene family required for germ cell development. It encodes an RNA-binding protein which is more similar to Drosophila Boule than to human proteins encoded by genes DAZ (deleted in azoospermia) or DAZL (deleted in azoospermia-like). Loss of this gene function results in the absence of sperm in semen (azoospermia). Histological studies demonstrated that the primary defect is at the meiotic G2/M transition. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (1) encodes the longer isoform (1).