Nck beta (NCK2) (NM_001004720) Human Untagged Clone

CAT#: SC300759

NCK2 (untagged)-Human NCK adaptor protein 2 (NCK2), transcript variant 2


  "NM_001004720" in other vectors (4)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
NCK2 mouse monoclonal antibody,clone OTI4H7
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Nck beta"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol Nck beta
Synonyms GRB4; NCKbeta
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC300759 representing NM_001004720.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACAGAAGAAGTTATTGTGATAGCCAAGTGGGACTACACCGCCCAGCAGGACCAGGAGCTGGACATC
AAGAAGAACGAGCGGCTGTGGTTGCTGGACGACTCCAAGACGTGGTGGCGGGTGAGGAACGCGGCCAAC
AGGACGGGCTATGTACCGTCCAACTACGTGGAGCGGAAGAACAGCCTGAAGAAGGGCTCCCTCGTGAAG
AACCTGAAGGACACACTAGGCCTCGGCAAGACGCGCAGGAAGACCAGCGCGCGGGATGCGTCCCCCACG
CCCAGCACGGACGCCGAGTACCCCGCCAATGGCAGCGGCGCCGACCGCATCTACGACCTCAACATCCCG
GCCTTCGTCAAGTTCGCCTATGTGGCCGAGCGGGAGGATGAGTTGTCCCTGGTGAAGGGGTCGCGCGTC
ACCGTCATGGAGAAGTGCAGCGACGGTTGGTGGCGGGGCAGCTACAACGGGCAGATCGGCTGGTTCCCC
TCCAACTACGTCTTGGAGGAGGTGGACGAGGCGGCTGCGGAGTCCCCAAGCTTCCTGAGCCTGCGCAAG
GGCGCCTCGCTGAGCAATGGCCAGGGCTCCCGCGTGCTGCATGTGGTCCAGACGCTGTACCCCTTCAGC
TCAGTCACCGAGGAGGAGCTCAACTTCGAGAAGGGGGAGACCATGGAGGTGATTGAGAAGCCGGAGAAC
GACCCCGAGTGGTGGAAATGCAAAAATGCCCGGGGCCAGGTGGGCCTCGTCCCCAAAAACTACGTGGTG
GTCCTCAGTGACGGGCCTGCCCTGCACCCTGCGCACGCCCCACAGATAAGCTACACCGGGCCCTCGTCC
AGCGGGCGCTTCGCGGGCAGAGAGTGGTACTACGGGAACGTGACGCGGCACCAGGCCGAGTGCGCCCTC
AACGAGCGGGGCGTGGAGGGCGACTTCCTCATTAGGGACAGCGAGTCCTCGCCCAGCGACTTCTCCGTG
TCCCTTAAAGCGTCAGGGAAGAACAAACACTTCAAGGTGCAGCTCGTGGACAATGTCTACTGCATTGGG
CAGCGGCGCTTCCACACCATGGACGAGCTGGTGGAACACTACAAAAAGGCGCCCATCTTCACCAGCGAG
CACGGGGAGAAGCTCTACCTCGTCAGGGCCCTGCAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001004720
Insert Size 1143 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001004720.2
RefSeq Size 2417 bp
RefSeq ORF 1143 bp
Locus ID 8440
UniProt ID O43639
Cytogenetics 2q12.2
Protein Families Druggable Genome
Protein Pathways Axon guidance, ErbB signaling pathway, Pathogenic Escherichia coli infection, T cell receptor signaling pathway
MW 42.9 kDa
Gene Summary This gene encodes a member of the NCK family of adaptor proteins. The protein contains three SH3 domains and one SH2 domain. The protein has no known catalytic function but has been shown to bind and recruit various proteins involved in the regulation of receptor protein tyrosine kinases. It is through these regulatory activities that this protein is believed to be involved in cytoskeletal reorganization. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same isoform (A).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.