RAB39B (NM_171998) Human Untagged Clone

CAT#: SC124691

Reviews ()
Write a review

RAB39B (untagged)-Human RAB39B, member RAS oncogene family (RAB39B)



  "NM_171998" in other vectors (7)

Reconstitution Protocol

USD 300.00


Availability*
In Stock

Size
    • 10 ug


Product images

Other products for "RAB39B"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RAB39B
Synonyms BGMR; MRX72; WSMN; WSN
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC124691 sequence for NM_171998 edited (data generated by NextGen Sequencing)
ATGGAGGCCATCTGGCTGTACCAGTTCCGGCTCATTGTCATCGGGGATTCCACAGTGGGC
AAGTCCTGCCTGATCCGCCGCTTCACCGAGGGTCGCTTTGCCCAGGTTTCTGACCCCACC
GTGGGGGTGGATTTTTTCTCCCGCTTGGTGGAGATCGAGCCAGGAAAACGCATCAAGCTC
CAGATCTGGGATACCGCGGGTCAAGAGAGGTTCAGATCCATCACTCGCGCCTACTACAGG
AACTCAGTAGGTGGTCTTCTCTTATTTGACATTACCAACCGCAGGTCCTTCCAGAATGTC
CATGAGTGGTTAGAAGAGACCAAAGTACACGTTCAGCCCTACCAAATTGTATTTGTTCTG
GTGGGTCACAAGTGTGACCTGGATACACAGAGGCAAGTGACTCGCCACGAGGCCGAGAAA
CTGGCTGCTGCATACGGCATGAAGTACATTGAAACGTCAGCCCGAGATGCCATTAATGTG
GAGAAAGCCTTCACAGACCTGACAAGAGACATATATGAGCTGGTTAAAAGGGGGGAGATT
ACAATCCAGGAGGGCTGGGAAGGGGTGAAGAGTGGATTTGTACCAAATGTGGTTCACTCT
TCAGAAGAGGTTGTCAAATCAGAGAGGAGATGTTTGTGCTAG

Clone variation with respect to NM_171998.2
>OriGene 5' read for NM_171998 unedited
GTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGGTCGGCGGGGCGCCCCC
TCCCGCCGTCCCCGGTCCGGGCCAAGGAGACCTGCAGAGCCGCGGCCATGGAGGCCATCT
GGCTGTACCAGTTCCGGCTCATTGTCATCGGGGATTCCACAGTGGGCAAGTCCTGCCTGA
TCCGCCGCTTCACCGAGGGTCGCTTTGCCCAGGTTTCTGACCCCACCGTGGGGGTGGATT
TTTTCTCCCGCTTGGTGGAGATCGAGCCAGGAAAACGCATCAAGCTCCAGATCTGGGATA
CCGCGGGTCAAGAGAGGTTCAGATCCATCACTCGCGCCTACTACAGGAACTCAGTAGGTG
GTCTTCTCTTATTTGACATTACCAACCGCAGGTCCTTCCAGAATGTCCATGAGTGGTTAG
AAGAGACCAAAGTACACGTTCAGCCCTACCAAATTGTATTTGTTCTGGTGGGTCACAAGT
GTGACCTGGATACACAGAGGCAAGTGACTCGCCACGAGGCCGAGAAACTGGCTGCTGCAT
ACGGCATGAAGTACATTGAAACGTCAGCCCGAGATGCCATTAATGTGGAGAAAGCCTTCA
CAGACCTGACAAGAGACATATATGAGCTGGTTAAAAGGGGGGAGATTACAATCCAGGAGG
GCTGGGAAGGGGTGAAGAGTGGATNTGTACCANATGTGGTTCACTCTTCAGAAGAAGTTG
TCAAATCAGAGAGGAGATGTTTGTGCTAGTCAGTTCTTTTATTTCCAAAACATGCTCTNC
TACTTGNACNNTGAAAGTAGAGAAATAAATAGAATCTTTGTGTAACTGATGAGAACTCAA
CCTCCATTTGGAATACCAAGTGAGCCTCCCTCTCNAGGGGACTCTGACANGACTCGTGTG
CGGTGGAAATGGGGGTGCCCCTGAATGCTGTGACAAAGGNACTGNAATGCTGACATGGC
Restriction Sites ECoRI-NOT     
ACCN NM_171998
Insert Size 2700 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_171998.2, NP_741995.1
RefSeq Size 3499 bp
RefSeq ORF 642 bp
Locus ID 116442
UniProt ID Q96DA2
Cytogenetics Xq28
Protein Families Druggable Genome
Gene Summary This gene encodes a member of the Rab family of proteins. Rab proteins are small GTPases that are involved in vesicular trafficking. Mutations in this gene are associated with X-linked cognitive disability. [provided by RefSeq, Aug 2013]

Other Versions

Frequently bought together (4)
Rabbit Polyclonal Anti-RAB39B Antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.