RAB39B (NM_171998) Human Untagged Clone

CAT#: SC323711

Reviews ()
Write a review

RAB39B (untagged)-Human RAB39B, member RAS oncogene family (RAB39B)



Reconstitution Protocol

USD 300.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RAB39B
Synonyms BGMR; MRX72; WSMN; WSN
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_171998.2 CTCTTACAGATAGTGCGGCGGCCCAGGCGTCGCGTCTACGCGGGGGATTACAGTAACCCG
GTTGTCAGTGATGAGTCAGAGTGCGTGGTGCTGATGCTGCTGCCATTTCATCACCTTTGC
GAGCGCAGCATCCATCCCTCCGCTCTCCCGGCGCCTGGGCCTACCCAGCTTCGGGCTCCC
AGGCCAGCGATGCGCTCGCGGCTGAGCTAGATCCTGCCGAGCCGCGCTCTCTGAGGCGTC
GGCGGGGCGCCCCCTCCCGCCGTCCCCGGTCCGGGCCAAGGAGACCTGCAGAGCCGCGGC
CATGGAGGCCATCTGGCTGTACCAGTTCCGGCTCATTGTCATCGGGGATTCCACAGTGGG
CAAGTCCTGCCTGATCCGCCGCTTCACCGAGGGTCGCTTTGCCCAGGTTTCTGACCCCAC
CGTGGGGGTGGATTTTTTCTCCCGCTTGGTGGAGATCGAGCCAGGAAAACGCATCAAGCT
CCAGATCTGGGATACCGCGGGTCAAGAGAGGTTCAGATCCATCACTCGCGCCTACTACAG
GAACTCAGTAGGTGGTCTTCTCTTATTTGACATTACCAACCGCAGGTCCTTCCAGAATGT
CCATGAGTGGTTAGAAGAGACCAAAGTACACGTTCAGCCCTACCAAATTGTATTTGTTCT
GGTGGGTCACAAGTGTGACCTGGATACACAGAGGCAAGTGACTCGCCACGAGGCCGAGAA
ACTGGCTGCTGCATACGGCATGAAGTACATTGAAACGTCAGCCCGAGATGCCATTAATGT
GGAGAAAGCCTTCACAGACCTGACAAGAGACATATATGAGCTGGTTAAAAGGGGGGAGAT
TACAATCCAGGAGGGCTGGGAAGGGGTGAAGAGTGGATTTGTACCAAATGTGGTTCACTC
TTCAGAAGAGGTTGTCAAATCAGAGAGGAGATGTTTGTGCTAGTCAGTTCTTTTATTTCC
AAAACATGCTCTCCTACTTGAACTGAAAAGTAAGAGAAATAAATAGAATCTTTGTGTAAA
AAAAAAAAAAAA
Restriction Sites ECoRI-NOT     
ACCN NM_171998
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_171998.2, NP_741995.1
RefSeq Size 3499 bp
RefSeq ORF 642 bp
Locus ID 116442
UniProt ID Q96DA2
Cytogenetics Xq28
Protein Families Druggable Genome
Gene Summary This gene encodes a member of the Rab family of proteins. Rab proteins are small GTPases that are involved in vesicular trafficking. Mutations in this gene are associated with X-linked cognitive disability. [provided by RefSeq, Aug 2013]
Other products for "RAB39B"
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.