BMI1 (NM_005180) Human Untagged Clone

CAT#: SC116894

BMI1 (untagged)-Human BMI1 polycomb ring finger oncogene (BMI1)

USD 505.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name BMI1 (NM_005180) Human Untagged Clone
Symbol BMI1
Synonyms FLVI2/BMI1; PCGF4; RNF51
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_005180 edited
ATGCATCGAACAACGAGAATCAAGATCACTGAGCTAAATCCCCACCTGATGTGTGTGCTT
TGTGGAGGGTACTTCATTGATGCCACAACCATAATAGAATGTCTACATTCCTTCTGTAAA
ACGTGTATTGTTCGTTACCTGGAGACCAGCAAGTATTGTCCTATTTGTGATGTCCAAGTT
CACAAGACCAGACCACTACTGAATATAAGGTCAGATAAAACTCTCCAAGATATTGTATAC
AAATTAGTTCCAGGGCTTTTCAAAAATGAAATGAAGAGAAGAAGGGATTTTTATGCAGCT
CATCCTTCTGCTGATGCTGCCAATGGCTCTAATGAAGATAGAGGAGAGGTTGCAGATGAA
GATAAGAGAATTATAACTGATGATGAGATAATAAGCTTATCCATTGAATTCTTTGACCAG
AACAGATTGGATCGGAAAGTAAACAAAGACAAAGAGAAATCTAAGGAGGAGGTGAATGAT
AAAAGATACTTACGATGCCCAGCAGCAATGACTGTGATGCACTTAAGAAAGTTTCTCAGA
AGTAAAATGGACATACCTAATACTTTCCAGATTGATGTCATGTATGAGGAGGAACCTTTA
AAGGATTATTATACACTAATGGATATTGCCTACATTTATACCTGGAGAAGGAATGGTCCA
CTTCCATTGAAATACAGAGTTCGACCTACTTGTAAAAGAATGAAGATCAGTCACCAGAGA
GATGGACTGACAAATGCTGGAGAACTGGAAAGTGACTCTGGGAGTGACAAGGCCAACAGC
CCAGCAGGAGGTATTCCCTCCACCTCTTCTTGTTTGCCTAGCCCCAGTACTCCAGTGCAG
TCTCCTCATCCACAGTTTCCTCACATTTCCAGTACTATGAATGGAACCAGCAACAGCCCC
AGCGGTAACCACCAATCTTCTTTTGCCAATAGACCTCGAAAATCATCAGTAAATGGGTCA
TCAGCAACTTCTTCTGGTTGA
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_005180
ORF Size 981 bp
Insert Size 2700
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_005180.5.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_005180.5, NP_005171
RefSeq Size 3251
Locus ID 648
Cytogenetics 10p12.2
Domains RING
Protein Families ES Cell Differentiation/IPS, Transcription Factors, Druggable Genome
Gene Summary This gene encodes a ring finger protein that is major component of the polycomb group complex 1 (PRC1). This complex functions through chromatin remodeling as an essential epigenetic repressor of multiple regulatory genes involved in embryonic development and self-renewal in somatic stem cells. This protein also plays a central role in DNA damage repair. This gene is an oncogene and aberrant expression is associated with numerous cancers and is associated with resistance to certain chemotherapies. A pseudogene of this gene is found on chromosome X. Read-through transcription also exists between this gene and the upstream COMM domain containing 3 (COMMD3) gene. [provided by RefSeq, Sep 2015]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations