EVI1(MECOM) (NM_005241) Human Untagged Clone

CAT#: SC107040

MECOM (untagged)-Human MDS1 and EVI1 complex locus (MECOM), transcript variant 2

USD 1,041.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name EVI1(MECOM) (NM_005241) Human Untagged Clone
Symbol MECOM
Synonyms AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3
Vector pCMV6-XL6
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC107040 sequence for NM_005241 edited (data generated by NextGen Sequencing)
ATGAAGAGCGAAGACTATCCCCATGAAACTATGGCGCCGGATATCCACGAAGAACGGCAA
TATCGCTGCGAAGACTGTGACCAGCTCTTTGAATCTAAGGCTGAACTAGCAGATCACCAA
AAGTTTCCATGCAGTACTCCTCACTCAGCATTTTCAATGGTTGAAGAGGACTTTCAGCAA
AAACTCGAAAGCGAGAATGATCTCCAAGAGATACACACGATCCAGGAGTGTAAGGAATGT
GACCAAGTTTTTCCTGATTTGCAAAGCCTGGAGAAACACATGCTGTCACATACTGAAGAG
AGGGAATACAAGTGTGATCAGTGTCCCAAGGCATTTAACTGGAAGTCCAATTTAATTCGC
CACCAGATGTCACATGACAGTGGAAAGCACTATGAATGTGAAAACTGTGCCAAGGTTTTC
ACGGACCCTAGCAACCTTCAGCGGCACATTCGCTCTCAGCATGTCGGTGCCCGGGCCCAT
GCATGCCCGGAGTGTGGCAAAACGTTTGCCACTTCGTCGGGCCTCAAACAACACAAGCAC
ATCCACAGCAGTGTGAAGCCCTTTATCTGTGAGGTCTGCCATAAATCCTATACTCAGTTT
TCAAACCTTTGCCGTCATAAGCGCATGCATGCTGATTGCAGAACCCAAATCAAGTGCAAA
GACTGTGGACAAATGTTCAGCACTACGTCTTCCTTAAATAAACACAGGAGGTTTTGTGAG
GGCAAGAACCATTTTGCGGCAGGTGGATTTTTTGGCCAAGGCATTTCACTTCCTGGAACC
CCAGCTATGGATAAAACGTCCATGGTTAATATGAGTCATGCCAACCCGGGCCTTGCTGAC
TATTTTGGCGCCAATAGGCATCCTGCTGGTCTTACCTTTCCAACAGCTCCTGGATTTTCT
TTTAGCTTCCCTGGTCTGTTTCCTTCCGGCTTGTACCACAGGCCTCCTTTGATACCTGCT
AGTTCTCCTGTTAAAGGACTATCAAGTACTGAACAGACAAACAAAAGTCAAAGTCCCCTC
ATGACACATCCTCAGATACTGCCAGCTACACAGGATATTTTGAAGGCACTATCTAAACAC
CCATCTGTAGGGGACAATAAGCCAGTGGAGCTCCAGCCCGAGAGGTCCTCTGAAGAGAGG
CCCTTTGAGAAAATCAGTGACCAGTCAGAGAGTAGTGACCTTGATGATGTCAGTACACCA
AGTGGCAGTGACCTGGAAACAACCTCGGGCTCTGATCTGGAAAGTGACATTGAAAGTGAT
AAAGAGAAATTTAAAGAAAATGGTAAAATGTTCAAAGACAAAGTAAGCCCTCTTCAGAAT
CTGGCTTCAATAAATAATAAGAAAGAATACAGCAATCATTCCATTTTCTCACCATCTTTA
GAGGAGCAGACTGCGGTGTCAGGAGCTGTGAATGATTCTATAAAGGCTATTGCTTCTATT
GCTGAAAAATACTTTGGTTCAACAGGACTGGTGGGGCTGCAAGACAAAAAAGTTGGAGCT
TTACCTTACCCTTCCATGTTTCCCCTCCCATTTTTTCCAGCATTCTCTCAATCAATGTAC
CCATTTCCTGATAGAGACTTGAGATCGTTACCTTTGAAAATGGAACCCCAATCACCAGGT
GAAGTAAAGAAACTGCAGAAGGGCAGCTCTGAGTCCCCCTTTGATCTCACCACTAAGCGA
AAGGATGAGAAGCCCTTGACTCCAGTCCCCTCCAAGCCTCCAGTGACACCTGCCACAAGC
CAAGACCAGCCCCTGGATCTAAGTATGGGCAGTAGGAGTAGAGCCAGTGGGACAAAGCTG
ACTGAGCCTCGAAAAAACCACGTGTTTGGGGGAAAAAAAGGAAGCAACGTCGAATCAAGA
CCTGCTTCAGATGGTTCCTTGCAGCATGCAAGACCCACTCCTTTCTTTATGGACCCTATT
TACAGAGTAGAGAAAAGAAAACTAACTGACCCACTTGAAGCTTTAAAAGAGAAATACTTG
AGGCCTTCTCCAGGATTCTTGTTTCACCCACAATTCCAACTGCCTGATCAGAGAACTTGG
ATGTCAGCTATTGAAAACATGGCAGAAAAGCTAGAGAGCTTCAGTGCCCTGAAACCTGAG
GCCAGTGAGCTCTTACAGTCAGTGCCCTCTATGTTCAACTTCAGGGCGCCTCCCAATGCC
CTGCCAGAGAACCTTCTGCGGAAGGGAAAGGAGCGCTATACCTGCAGATACTGTGGCAAG
ATTTTTCCAAGGTCTGCAAACCTAACACGGCACTTGAGAACCCACACAGGAGAGCAGCCT
TACAGATGCAAATACTGTGACAGATCATTTAGCATATCTTCTAACTTGCAAAGGCATGTT
CGCAACATCCACAATAAAGAGAAGCCATTTAAGTGTCACTTATGTGATAGGTGTTTTGGT
CAACAAACCAATTTAGACAGACACCTAAAGAAACATGAGAATGGGAACATGTCCGGTACA
GCAACATCGTCGCCTCATTCTGAACTGGAAAGTACAGGTGCGATTCTGGATGACAAAGAA
GATGCTTACTTCACAGAAATTCGAAATTTCATTGGGAACAGCAACCATGGCAGCCAATCT
CCCAGGAATGTGGAGGAGAGAATGAATGGCAGTCATTTTAAAGATGAAAAGGCTTTGGTG
ACCAGTCAAAATTCAGACTTGCTGGATGATGAAGAAGTTGAAGATGAGGTGTTGTTAGAT
GAGGAGGATGAAGACAATGATATTACTGGAAAAACAGGAAAGGAACCAGTGACAAGTAAT
TTACATGAAGGAAACCCTGAGGATGACTATGAAGAAACCAGTGCCCTGGAGATGAGTTGC
AAGACATCCCCAGTGAGGTATAAAGAGGAAGAATATAAAAGTGGACTTTCTGCTCTAGAT
CATATAAGGCACTTCACAGATAGCCTCAAAATGAGGAAAATGGAAGATAATCAATATTCT
GAAGCTGAGCTGTCTTCTTTTAGTACTTCCCATGTGCCAGAGGAACTTAAGCAGCCGTTA
CACAGAAAGTCCAAATCGCAGGCATATGCTATGATGCTGTCACTGTCTGACAAGGAGTCC
CTCCATTCTACATCCCACAGTTCTTCCAACGTGTGGCACAGTATGGCCAGGGCTGCGGCG
GAATCCAGTGCTATCCAGTCCATAAGCCACGTATGA

Clone variation with respect to NM_005241.3
5' Read Nucleotide Sequence
>OriGene 5' read for NM_005241 unedited
ACAGTAATTACCCCCGCCCGTTGACGCAAAGGGCGGTAGGCGTGTACGGTGGGAGGTCTA
TATAAGCAGAGCTCATTTAGGTGACACTATAGAATACAAGCTACTTGTTCTTTTTGCAGC
GGCCGCGAATTCGGCACGAGGCCGCAGTCTCGCGGAGCCCTGCTGCTTATCTACGTTGCT
AAGCCGGGCGATTTCCTTGTTCCTCCTGCGAAACGGTGCGGTCTGGACACGTCTCCGGGG
TGGGTCGTCCGGCCTTCGATCTTAGACGAATTTTACAATGTGAAGTTCTGCATAGATGCC
AGTCAACCAGATGTTGGAAGCTGGCTCAAGTACATTAGATTCGCTGGCTGTTATGATCAG
CACAACCTTGTTGCATGCCAGATAAATGATCAGATATTCTATAGAGTAGTTGCAGACATT
GCGCCGGGAGAGGAGCTTCTGCTGTTCATGAAGAGCGAAGACTATCCCCATGAAACTATG
GCGCCGGATATCCACGAAGAACGGCAATATCGCTGCGAAGACTGTGACCAGCTCTTTGAA
TCTAAGGCTGAACTAGCAGATCACCAAAAGTTTCCATGCAGTACTCCTCACTCAGCATTT
TCAATGGTTGAAGAGGACTTTCAGCAAAAACTCGAAAGCGAGAATGATCTCCAAGAGATA
CACACGATCCAGGAGTGTAAGGAATGTGACCAAGTTTTTCCTGATTTGCAAAGCCTGGAG
AACACATGCTGTCACATACTGAAGAGAGGGAATACACGTGTGATCAGTGTCCCAAGGCAT
TTAACTGGCAGTCCAATTTAATTCGCCACCAGATGTCACATGACAGTGGAAAGCACTATG
AATGTGACCACTGTGCCCAGGTTTTACGGACCCTAGCACCTTCAGGGGACATTCGCTCTC
GCATGTCGGTGCCCGGCC
3' Read Nucleotide Sequence
>OriGene 3' read for NM_005241 unedited
TCGATCATCGGCTGATGGCAACTTCCCAGTTCCAGGANAGCACTGGGGCAGGGAGTCACA
GGGCATGCCACCCGGGTATCTGTTCAGGAAAACAGCTATGACCGCGGCCGCAATCTAGAG
TCGAGTTTTTTTTTTTTTTTTTTTCTTTTTAAAATCATTCAGTTTAAGGTCACTAGACTT
TAGATGAGTGACCCTGCAGGTTTATAAGGCATTCTGCTCAGCAGTCTTGTAAATAGTCCT
ATATGAAAGAGCCATGCTACTGTTGGACTTGGTCCCACTCTGGTCAACCTTGATAACGTC
ATACGTGGCTTATGGACTGGATAGCACTGGATTCCGCCGCAGCCCTGGCCATACTGTGCC
ACACGTTGGAAGAACTGTGGGATGTAGAATGGAGGGACTCCTTGTCAGACAGTGACAGCA
TCATAGCATATGCCTGCGATTTGGACTTTCTGTGTAACGGCTGCTTAAGTTCCTCTGGCA
CATGGGAAGTACTAAAAGAAGACAGCTCAGCTTCAGAATATTGATTATCTTCCATTTTCC
TCATTTTGAGGCTATCTGTGAAGTGCCTTATATGATCTAGAGCAGAAAGTCCACTTTTAT
ATTCTTCCTCTTTATACCTCACTGGGGATGTCTTGCAACTCATCTCCAGGGCACTGGTTT
CTTCATAGTCATCCTCAGGGTTTCCTTCATGTAAATTACTTGTCACTGGTTCCTTTCCTG
TTTTTCCAGTAATATCATTGTCTTCATCCTCCTCATCTAACAACACCTCATCTTCAACTT
CTTTATCATCCAGCAAGTCTGAATTTTGACTGGTCACCAAGCCTTTTCATCTTTAAATGA
CTGCCTTTCTTCTCTTCTCCACATTCCTGGGAGATTGGCTGCCATGGTTGCTGTTCCCAT
GAAATTTCAAATT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_005241
ORF Size 3156 bp
Insert Size 4000
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_005241.1, NP_005232
RefSeq Size 3570
Locus ID 2122
Cytogenetics 3q26.2
Protein Families Transcription Factors, Druggable Genome
Protein Pathways MAPK signaling pathway, Pathways in cancer, Chronic myeloid leukemia
Gene Summary The protein encoded by this gene is a transcriptional regulator and oncoprotein that may be involved in hematopoiesis, apoptosis, development, and cell differentiation and proliferation. The encoded protein can interact with CTBP1, SMAD3, CREBBP, KAT2B, MAPK8, and MAPK9. This gene can undergo translocation with the AML1 gene, resulting in overexpression of this gene and the onset of leukemia. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
Transcript Variant: This variant (2, also known as EVI1_1c) lacks a portion of the 5' UTR and 5' coding region, initiates translation at a downstream start codon, and uses an alternate in-frame splice site in the central coding region, compared to variant 1. The encoded isoform (b) is shorter at the N-terminus compared to isoform a. Variants 2, 3, and 7 all encode the same isoform.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations