Cbx5 (NM_001076789) Mouse Untagged Clone
CAT#: MC226181
Cbx5 (untagged) - Mouse chromobox 5 (Cbx5), transcript variant 2
"NM_001076789" in other vectors (2)
Product Images
Frequently bought together (3)
Other products for "Cbx5"
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Cbx5 |
Synonyms | 2610029O15Rik; C75991; HP1; Hp1a; Hp1alpha |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC226181 representing NM_001076789
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGAAAGAAGACCAAGAGGACAGCCGACAGCTCTTCTTCAGAGGATGAGGAGGAATATGTGGTGGAAA AGGTGTTGGACAGGCGCATGGTTAAGGGGCAAGTGGAATATCTGTTGAAGTGGAAAGGCTTTTCTGAGGA GCACAATACTTGGGAACCTGAGAAGAACTTGGATTGTCCTGAACTAATTTCTGAGTTTATGAAAAAGTAT AAGAAGATGAAGGAGGGTGAAAACAATAAGCCCAGGGAGAAATCAGAAGGAAACAAGAGGAAATCCAGTT TCTCCAACAGCGCTGATGATATTAAATCTAAAAAAAAGAGAGAGCAAAGCAATGATATCGCTCGGGGCTT TGAGAGAGGACTGGAACCAGAAAAGATCATCGGAGCAACAGATTCCTGCGGTGACTTAATGTTCTTAATG AAATGGAAAGACACAGATGAAGCTGACCTGGTTCTTGCAAAAGAAGCTAACGTGAAGTGTCCACAGATTG TGATAGCATTTTATGAAGAGAGACTGACGTGGCACGCATATCCAGAGGATGCGGAAAACAAAGAAAAAGA AAGCGCGAAGAGCTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001076789 |
Insert Size | 576 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001076789.1, NP_001070257.1 |
RefSeq Size | 8801 bp |
RefSeq ORF | 576 bp |
Locus ID | 12419 |
UniProt ID | Q61686 |
Cytogenetics | 15 F3 |
Gene Summary | Component of heterochromatin that recognizes and binds histone H3 tails methylated at 'Lys-9' (H3K9me), leading to epigenetic repression. In contrast, it is excluded from chromatin when 'Tyr-41' of histone H3 is phosphorylated (H3Y41ph). Can interact with lamin-B receptor (LBR). This interaction can contribute to the association of the heterochromatin with the inner nuclear membrane. Involved in the formation of functional kinetochore through interaction with MIS12 complex proteins (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1, 2, 3 and 4 encode the same protein. Sequence Note: This RefSeq record was created from genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.