Scube1 (NM_022723) Mouse Untagged Clone

CAT#: MC222998

Scube1 (untagged) - Mouse signal peptide, CUB domain, EGF-like 1 (Scube1), (10ug)

  View "NM_022723" in other vectors (2)

USD 1,310.00


Availability*
5 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Scube1 (NM_022723) Mouse Untagged Clone
Symbol Scube1
Synonyms 7330410C13Rik; A630023E24Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Cell Selection Neomycin
Sequence Data
>MC222998 representing NM_022723
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGCGCGGCGGCCGTGCGCTGGCACTTGTACCTACTGCTCGCTCTGGGAGCGCGCGGGCGGCTGGTGG
GGGGCAGCGGGCTGCCAGGAGCCGTGGACGTGGATGAATGCTCAGAGGGCACAGACGACTGCCACATAGA
TGCCATCTGCCAGAACACACCCAAGTCTTACAAATGTCTCTGCAAGCCCGGCTATAAGGGGGAAGGAAGG
CAGTGTGAAGACATTGACGAGTGTGAGAATGACTACTACAACGGGGGCTGTGTCCATGACTGCATCAACA
TCCCTGGGAACTACAGGTGCACCTGCTTTGATGGCTTCATGCTGGCCCATGATGGACACAACTGCCTGGA
TGTAGATGAGTGTCAAGACAACAACGGCGGCTGCCAGCAGATCTGCGTCAATGCCATGGGCAGCTATGAA
TGCCAGTGCCACAGCGGCTTTTTTCTCAGTGACAACCAACACACCTGCATACACCGCTCCAATGAGGGTA
TGAACTGCATGAACAAAGACCATGGCTGTGCCCACATCTGCCGGGAGACGCCCAAAGGTGGGGTAGCCTG
TGACTGCAGGCCCGGCTTTGACCTTGCCCAAAACCAGAAGGACTGCACACTAACCTGTAACTATGGAAAC
GGAGGCTGTCAGCACAGCTGCGAGGACACGGACACGGGCCCCATGTGTGGCTGCCACCAGAAGTACGCCT
TACATGCAGATGGTCGGACGTGCATCGAGACATGTGCAGTGAACAACGGAGGCTGTGACCGGACGTGTAA
GGACACTGCCACTGGCGTGCGGTGCAGCTGCCCGGTTGGATTCACGCTGCAGCCAGATGGAAAGACATGC
AAAGACATCAACGAGTGCTTGATGAATAACGGAGGCTGCGACCACTTCTGCCGAAACACCGTGGGCAGCT
TTGAATGCGGCTGCCAAAAGGGCCACAAGCTACTGACGGACGAGCGGACATGCCAAGACATTGACGAGTG
TTCCTTTGAGCGGACCTGTGACCACATCTGCATCAACTCCCCCGGCAGTTTCCAGTGCCTGTGCCGCCGA
GGCTACACACTCTACGGGACAACCCACTGCGGAGACGTGGATGAATGTAGCATGAACAACGGCAGCTGTG
AGCAGGGCTGTGTCAACACCAAGGGCAGCTACGAGTGTGTGTGCCCACCAGGGAGGAGGCTGCACTGGAA
TCAGAAGGACTGTGTGGAGATGAACGGGTGCCTGTCTCGGTCCAAGGCCTCTGCCCAGGCCCAGCTGTCC
TGTGGCAAGGTGGGTGGAGTGGAAAACTGCTTCCTGTCCTGCCTGGGCCACAGTCTCTTCATGCCAGATT
CAGAAAGCAGCTACATCCTGAGCTGTGGTGTTCCAGGTCTCCAGGGCAAGACACTGCCAAAACGCAATGG
CACTAGCTCCAGTACAGGGCCCGGCTGCTCAGATGCCCCCACCACCCCTATCAGACAGAAGGCCCGCTTC
AAGATCAGAGATGCCAAGTGCCATCTCCAGCCCCGCAGCCAGGAGCGAGCCAAGGATACCCTGAGGCATC
CCCTTTTAGACAACTGCCACGTGACTTTTGTGACCCTCAAGTGTGACTCCTCCAAGAAGAGGCGCCGAGG
CCGCAAGTCCCCATCCAAGGAGGTGTCCCACATCACAGCAGAGTTTGAGGTGGAGATGAAGGTGGATGAG
GCCTCAGGCACCTGCGAAGCAGACTGCATGCGGAAGCGTGCCGAGCAGAGCCTGCAAGCCGCCATCAAGA
TTCTGCGCAAGTCCATTGGTCGGAACCAGTTCTATGTCCAGGTCTTGGGCACTGAGTACGAGGTGGCCCA
GCGGCCAGCCAAAGCACTGGAGGGAACCGGGACTTGCGGCATAGGCCAAATACTACAGGACGGCAAGTGT
GTACCGTGTGCTCCTGGCACCTACTTCAGTGGTGACCCAGGCCAGTGTATGCCATGCGTGTCGGGAACCT
ACCAGGACATGGAAGGCCAGCTCAGCTGCACGCCATGCCCCAGCAGCGAAGGACTGGGTCTGGCTGGTGC
CCGAAACGTATCCGAATGTGGAGGCCAGTGCTCTCCAGGCTACTTCTCAGCGGATGGGTTCAAGCCTTGC
CAGGCCTGCCCTGTGGGCACATACCAGCCCGAGCCTGGGCGAACCGGCTGCTTCCCCTGTGGAGGCGGGC
TGCTCACCAAACACACGGGTACCGCCTCTTTCCAGGACTGCGAGGCCAAAGTGCATTGCTCTCCCGGACA
CCACTACAATACCACCACCCACCGGTGTATCCGCTGTCCCGTGGGCACCTATCAGCCCGAGTTTGGCCAG
AACCATTGCATCTCCTGTCCGGGCAACACCAGCACCGATTTTGATGGTTCCACCAACGTCACACACTGCA
AGAACCAGCACTGCGGCGGCGAACTTGGTGACTACACAGGCTACATCGAGTCCCCCAACTACCCTGGCGA
CTACCCAGCCAATGCAGAGTGTGTGTGGCACATCGCACCTCCCCCAAAGCGCAGGATCCTAATCGTAGTC
CCGGAGATCTTCCTACCCATCGAGGACGAGTGTGGTGATGTCCTGGTCATGAGAAAGAGTGCCTCGCCCA
CGTCAGTCACCACCTATGAGACGTGCCAGACCTATGAGCGGCCCATCGCCTTTACCTCCCGTTCCCGCAA
ACTCTGGATCCAGTTCAAATCCAACGAAGCCAACAGTGGCAAAGGGTTTCAAGTGCCCTATGTCACCTAT
GATGAGGACTACCAGCAGCTAATAGAAGACATCGTGCGTGATGGGCGCTTATATGCCTCGGAGAACCATC
AGGAGATTTTGAAAGACAAGAAGCTGATCAAGGCCCTCTTTGACGTGCTGGCACACCCACAAAACTACTT
CAAATACACAGCCCAGGAGTCCAAGGAGATGTTCCCCCGGTCCTTTATCAAACTTCTGCGTTCCAAAGTG
TCTCGGTTCCTGCGGCCCTACAAATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_022723
ORF Size 2967 bp
Insert Size 2967
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_022723.3, NP_073560
RefSeq Size 7842
RefSeq ORF 2967
Locus ID 64706
Cytogenetics 15|15 E1

Other Versions

Other products for "Scube1"
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
40% off proteins and antibodies
68 Mouse Clones