Cnksr3 (BC031194) Mouse Untagged Clone

CAT#: MC218574

Reviews ()
Write a review

Cnksr3 (untagged) - Mouse Cnksr family member 3 (cDNA clone MGC:37681 IMAGE:5059479), (10ug)

  View "BC031194" in other vectors (6)

USD 710.00


Availability*
3 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Cnksr3 (BC031194) Mouse Untagged Clone
Symbol Cnksr3
Synonyms 6820402C05; MGC37681
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Cell Selection Neomycin
Sequence Data
>BC031194
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCAGTCTCCTGCAGACAGATCTCAAAAGATTCACGCTGGCGATGAGGTCATTCAAGTCAATCGGCAGA
CAGTGGTTGGGTGGCAGTTGAAAAATCTGGTGAGAAAGTTGAGAGAGAACCCCACGGGCGTGGTGCTGCT
GCTGAAGAAGAGGCCCACGGGCTCCTTCAGCTTCACTCCGGCCCCACTGAAGAACCTGCGGTGGAAGCCA
CCGCTCGTGCAGACCTCACCCCCGCCCACCACCACCCAGTCCCCAGAGAGTACCATGGATGCCTCCCTGA
AGAAGGAGAAGCCAGCCATCCTGGACCTATACATCCCTCCCCCACCTGCTGTCCCCTACTCTCCCCGGGA
TGAGAATGTGAGTTTCGGCTACAGAGGACACAGTAAGAGTAAGCAGCCGTTGCCTGTGCGCAAGGGTTCC
GAGTCCCCTAACTCCTTCCTGGACCAGGAGAGCCAAAGACGCAGATTTACCATTGCAGATTCCGATCAGC
TGCCCGGGTATTCGGTGGAAACCAATGTTCTGCCCACAAAAATGAGAGGGAAGACACCATCCTACGGCAA
ACCCCGGCCTCTGTCCATGCCTGCCGATGGGAACTGGATGGGGATCGTGGACCCTTTTGCTAAACCTCGA
GGAAATGGGAGGAAAGGGGAAGATGCCCTCTGCCGGTATTTCAGCAATGAGCGGATCACACCCATCACTG
AAGAAAGTGCCTCTCCTATGTACCGGTTCTCTAGACCCCTGACTGAGCGGCACCTGGTCCGAGGTGCGGA
CTACATCCGAGGGAGCAGGTGCTACATCAACTCCGACCTACACAGCAGTGCCACCATTCCATTCCAGGAG
GAAGGTTCCAAGAAGAAATCAGCCTCCTCATCGGCCAAGGCGTCCTCTGGGGAGCCGTCGCTGCTGGTCA
GCTGGCTGACTCGCCTCAAGCTGTTGACTCACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN BC031194
ORF Size 945 bp
Insert Size 945
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC031194
RefSeq Size 2566
RefSeq ORF 945
Locus ID 215748
Cytogenetics 10 A1

Other Versions

Other products for "Cnksr3"
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
40% off proteins and antibodies
68 Mouse Clones