Spag6l (NM_015773) Mouse Untagged Clone

CAT#: MC217158

Spag6 (untagged) - Mouse sperm associated antigen 6 (Spag6), (10ug)

USD 649.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Spag6l (NM_015773) Mouse Untagged Clone
Symbol Spag6l
Synonyms PF16; Spag6; Spag6l1
Vector pCMV6-Entry
Sequence Data
>MC217158 representing NM_015773
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGCCAGCGGCAGGTGCTGCAAGTGTTCGAGCAGTACCAGAAAGCCCGGACGCAATTCGTGCAGATGG
TGGCAGAGCTGGCGACAAGACCCCAAAACATCGAAACGCTGCAGAATGCAGGTGTAATGTCTTTGCTAAG
GCCGCTTCTTCTGGATGTGGTCCCAACAATTCAACAGACTGCAGCTTTGGCTCTGGGGAGACTGGCCAAT
TACAATGATGACTTAGCAGAAGCAGTCGTGAAAGGTGACATTCTTCCACAGCTTGTTTATTCATTGGCAG
AACAAAATCGTTTTTACAAGAAGGCAGCTGCCTTTGTGTTGAGAGCAGTTGGGAAACACTCTCCTCAGCT
GGCCCAGGCCATAGTTGACTGCGGAGCTCTGGATACACTGGTGATCTGCTTGGAGGATTTTGACCCTGGG
GTCAAGGAGGCTGCAGCCTGGGCACTCGGATACATTGCAAGACACAACACAGAATTATCTCAAGCCGTGG
TGGATGCAGGAGCAATTCCTCTTTTAGTCCTTTGTATCCAGGAGCCAGAAATTGCTTTGAAAAGGATCGC
TGCCTCGGCCCTCAGTGATATCTCAAAGCACTCCCCAGAGTTAGCACAGACGGTGGTGGACGCAGGAGCT
ATTGCTCACTTAGCCCAGATGATCCTCAACCCTGATGCAAAACTGAAGCGCCAGGTCCTCTCAGCTCTCA
GTCAGATTGCAAAGCATTCTGTGGACTTGGCAGAGATGGTTGTTGAAGCAGAGATTTTCCCTGTTGTACT
AACCTGCCTGAAGGACAAAGATGAATATGTGAAGAAAAATGCTTGCACCTTAATCAGAGAGATTGCAAAA
CACACGCCTGAGCTCTCGCAGCTGATTGTTAATGCAGGAGGCGTGGCTGCCGTGATCGATTGCATTGGGT
CCTGCAAAGGGAACATACGGCTGCCTGGCATCATGATGCTGGGTTACGTGGCTGCTCATTCTGAGAACCT
GGCCATGGCGGTGATCATCTCCAAGGGTGTACCCCAGTTGTCAATCTGCCTGTCAGAAGAACCAGAAGAT
CATATTAAGGCTGCTGCTGCCTGGGCCTTGGGGCAGCTGGGAAGACACACTCCAGAGCATGCCAGGGCTG
TGGCTGTCACAAACACGCTGCCAGTCCTGCTGTCTTTGTACATGTCACCAGAGAGCTCTGAGGACCTACA
GCTCAAAAGTAAAAAAGCCATAAAGAATATCCTTCAGAAATGCACCTACCTCCCAGCCCTTGAGCCGTTC
CTGTACGACGCACCTCCCAATATCCTGAAACATGTTGTTGGGCAGTTCAGTAAGGTGCTGCCACATGACA
GCAAAGCCCGGCGGCTTTTCGTGACTAGTGGTGGACTTAAAAAGGTTCAGGAGATAAAGGCAGAACCAGG
CTCTCTCCTGCAGGAATACATCAACAGCATCAACAATTGTTACCCAGAGGAAATAGTAAGGTATTATTCA
CCTGGATACTCCGATACACTTCTGCAGAGGGTGGACAGCTACCAACCACTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_015773
ORF Size 1524 bp
Insert Size 1524
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_015773.2, NP_056588
RefSeq Size 2483
RefSeq ORF 1524
Locus ID 50525
Cytogenetics 16|16 A3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.