Ppp5c (NM_011155) Mouse Untagged Clone

CAT#: MC216972

Ppp5c (untagged) - Mouse protein phosphatase 5, catalytic subunit (Ppp5c), (10ug)


  "NM_011155" in other vectors (4)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Ppp5c"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Ppp5c
Synonyms AU020526; PP5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC216972 representing NM_011155
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGATGGCGGAGGGCGAGCGGACTGAGTGTGCTGAGACCCCCCGGGACGAACCCCCGGCCGATGGCA
CTCTGAAGCGGGCAGAGGAGCTCAAGACACAGGCCAACGACTACTTCAAAGCCAAGGACTACGAGAACGC
GATCAAGTTCTACAGTCAGGCCATCGAGTTGAACCCCGGCAATGCCATCTACTATGGCAACCGCAGCCTG
GCCTACCTGCGCACTGAGTGCTATGGCTATGCACTGGGCGACGCCACACGGGCCATCGAGCTTGACAAGA
AGTACATCAAAGGCTACTACCGCCGGGCGGCCAGCAACATGGCACTGGGCAAGTTCCGGGCTGCCCTGCG
TGACTACGAGACGGTGGTGAAAGTGAAGCCTAATGACAAGGATGCCAAGATGAAGTACCAGGAGTGCAGC
AAGATTGTGAAGCAGAAGGCCTTTGAGAGGGCCATTGCGGGTGACGAGCACAGACGCTCTGTCGTGGACT
CTCTGGACATTGAAAGCATGACCATTGAAGATGAGTACAGCGGGCCCAAGCTTGAGGATGGCAAAGTGAC
AATCACCTTCATGAAAGACCTCATGCAGTGGTACAAGGATCAGAAGAAACTGCACCGGAAGTGCGCCTAC
CAGATCCTAGTACAGGTGAAAGAAGTCCTCTGCAAGCTGAGCACGCTGGTGGAGACGACGCTGAAAGAGA
CAGAGAAGATTACAGTGTGCGGGGACACCCATGGCCAGTTCTACGACCTCCTCAACATATTTGAGCTCAA
CGGTTTACCCTCAGAGACCAACCCCTATATATTTAATGGCGATTTTGTGGACCGTGGTTCCTTCTCCGTT
GAAGTGATCCTCACCCTCTTCGGCTTTAAGCTCCTGTATCCAGATCATTTCCATCTACTTCGAGGCAACC
ACGAGACAGACAACATGAACCAGATCTACGGGTTCGAGGGCGAGGTGAAGGCCAAGTACACAGCCCAGAT
GTATGAGCTCTTCAGCGAGGTGTTCGAGTGGCTTCCGCTGGCGCAGTGTATCAATGGCAAAGTGCTGATC
ATGCACGGAGGCCTATTCAGCGAAGATGGTGTCACTCTGGATGACATCCGAAAGATTGAGCGGAATCGGC
AGCCCCCAGACTCAGGTCCCATGTGTGACCTGCTGTGGTCAGATCCCCAGCCACAGAATGGGCGCTCCGT
CAGCAAGCGTGGTGTGAGTTGCCAGTTTGGGCCTGATGTCACCAAGGCCTTCCTGGAGGAGAATCAACTG
GACTATATCATCCGCAGCCATGAAGTCAAAGCCGAGGGCTACGAGGTGGCCCATGGTGGCCGCTGTGTCA
CTGTCTTTTCTGCCCCCAACTATTGTGACCAGATGGGAAACAAAGCCTCCTACATCCACCTCCAGGGCTC
CGACCTGCGGCCCCAGTTCCACCAATTCACAGCAGTGCCTCACCCCAATGTCAAGCCCATGGCATACGCC
AACACGCTTCTGCAGCTAGGAATGATGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_011155
Insert Size 1500 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_011155.2, NP_035285.2
RefSeq Size 2084 bp
RefSeq ORF 1500 bp
Locus ID 19060
UniProt ID Q60676
Cytogenetics 7 9.15 cM
Gene Summary Serine/threonine-protein phosphatase that dephosphorylates a myriad of proteins involved in different signaling pathways including the kinases CSNK1E, ASK1/MAP3K5, PRKDC and RAF1, the nuclear receptors NR3C1, PPARG, ESR1 and ESR2, SMAD proteins and TAU/MAPT. Implicated in wide ranging cellular processes, including apoptosis, differentiation, DNA damage response, cell survival, regulation of ion channels or circadian rhythms, in response to steroid and thyroid hormones, calcium, fatty acids, TGF-beta as well as oxidative and genotoxic stresses. Participates in the control of DNA damage response mechanisms such as checkpoint activation and DNA damage repair through, for instance, the regulation ATM/ATR-signaling and dephosphorylation of PRKDC and TP53BP1. Inhibits ASK1/MAP3K5-mediated apoptosis induced by oxidative stress. Plays a positive role in adipogenesis, mainly through the dephosphorylation and activation of PPARG transactivation function. Also dephosphorylates and inhibits the anti-adipogenic effect of NR3C1. Regulates the circadian rhythms, through the dephosphorylation and activation of CSNK1E. May modulate TGF-beta signaling pathway by the regulation of SMAD3 phosphorylation and protein expression levels. Dephosphorylates and may play a role in the regulation of TAU/MAPT. Through their dephosphorylation, may play a role in the regulation of ions channels such as KCNH2.[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.