Sbp (NM_011321) Mouse Untagged Clone

CAT#: MC209355

Sbp (untagged) - Mouse spermine binding protein (Sbp), (10ug)

USD 402.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Sbp (NM_011321) Mouse Untagged Clone
Symbol Sbp
Synonyms AV082137; AV082259; p25
Vector pCMV6-Entry
Sequence Data
>MC209355 representing NM_011321
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCTGCTGTTGCTGACTTTGGCTTTCCTGGCCAGTCCCACATGCAGAGCCCAGAATGTCCTGGGGAATG
CTGCTGGCAAGTATTTCTACGTTCAAGGTGAAGATCAGGGGCAACTCAAGGGCATGCGGATCTTCTTAAG
TGTTTTCAAGTTCATCAAGGGCTTCCAGCTGCAGTTTGGCAGTAACTGGACTGATGTCTATGGAACCCGG
TCAGATAACTTTATAGACTTCCTTCTGGAGGACGGAGAGCACGTGATAAAGGTAGAGGGCAGTGCAGTGA
TCTGCCTGACTTCCCTGACCTTCACTACAAACAAGGGGCGTGTGGCCACCTTTGGTGTTAGAAGGGGTCG
ATACTTCAGTGACACTGGAGGTTCAGACAAGCATCTAGTGACTGTCAATGGAATGCATGCACCGGGCCTC
TGCGTCAGAGGGATTGGCTTCAAATGGGGAAATATCAATGCTAATGGCAATGACCATTATAATAACAAGG
AAGATAAGGCTGACAACAAAGATGCTGACAACAAAGATGCTGACAACAAAGATGATGGAGATGAGGATGA
TGATGGAAACGATGATGATGACCAGAAAGATGAAAGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_011321
ORF Size 600 bp
Insert Size 600
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_011321.3, NP_035451
RefSeq Size 839
RefSeq ORF 600
Locus ID 20234
Cytogenetics 17|17 A3.3
Gene Summary This protein seems to be functional equivalent to rat prostatic spermine-binding protein, which is involved in polyamine binding. [UniProtKB/Swiss-Prot Function]
Transcript Variant:
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.