Elf3 (NM_007921) Mouse Untagged Clone

CAT#: MC208432

Elf3 (untagged) - Mouse E74-like factor 3 (Elf3), transcript variant 2, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Elf3
• Synonyms: ESE-1; ESX; jen
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC208432 representing NM_007921
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCTGCCACCTGTGAGATCAGCAACGTTTTTAGTAACTACTTCAACGCCATGTACAGCTCAGAAGACC
  CCACCCTGGCTCCTGCTCCTCCGACTACCTTTGGCACTGAAGACTTGGTGTTGACCCTGAACAACCAACA
  GATGACACTGGAAGGTCCAGAGAAGGCAAGCTGGACTAGCGAGCGGCCCCAGTTCTGGTCGAAGACCCAG
  GTTCTGGAGTGGATCAGCTACCAAGTGGAGAAGAACAAGTATGACGCCAGCTCCATCGACTTCTCCCGCT
  GCGACATGGACGGAGCCACCCTCTGCAGCTGTGCGCTGGAGGAGCTGCGGCTAGTCTTTGGACCTCTGGG
  AGACCAGCTCCATGCCCAGCTTCGGGACCTCACCTCCAACTCTTCTGATGAACTCAGCTGGATCATCGAG
  CTGCTGGAGAAGGATGGCATGTCCTTCCAAGAGAGCCTAGGCGACTCGGGCCCCTTTGATCAGGGAAGTC
  CTTTTGCCCAGGAACTCCTGGATGATGGCCGCCAGGCCAGTCCCTACTACTGCAGTACCTATGGCCCTGG
  AGCGCCCTCCCCCGGCAGCTCTGATGTCTCCACTGCAAGGACCGCTACTCCCCAGAGTTCCCATGCTTCT
  GACTCCGGTGGAAGTGATGTGGACCTGGACCTCACCGAGAGCAAGGTCTTCCCTAGAGATGGCTTTCCTG
  ACTATAAGAAGGGGGAACCCAAGCACGGGAAGAGGAAACGGGGGCGTCCCAGAAAGCTGAGCAAGGAATA
  CTGGGACTGTCTGGAGGGCAAGAAGAGCAAGCACGCCCCCAGAGGTACTCACCTGTGGGAGTTTATCCGA
  GACATCCTAATCCACCCCGAGCTCAACGAAGGCCTCATGAAGTGGGAGAACCGGCACGAGGGTGTGTTCA
  AGTTTCTTCGCTCAGAGGCCGTGGCCCAACTCTGGGGCCAGAAGAAGAAGAACAGCAACATGACCTATGA
  GAAGCTGAGCCGAGCCATGAGGTATTACTACAAACGGGAGATCCTGGAACGGGTGGATGGCCGACGGCTC
  GTCTACAAGTTTGGCAAGAACTCTAGTGGCTGGAAGGAAGAAGAGGTTGGAGAGAGTCGGAATTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_007921
• Insert Size: 1116 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_007921.3, NP_031947.1
• RefSeq Size: 1940 bp
• RefSeq ORF: 1116 bp
• Locus ID: 13710
• UniProt ID: Q3UPW2
• Cytogenetics: 1 E4
• Gene Summary: Transcriptional activator that binds and transactivates ETS sequences containing the consensus nucleotide core sequence GGA[AT]. Acts synergistically with POU2F3 to transactivate the SPRR2A promoter and with RUNX1 to transactivate the ANGPT1 promoter (By similarity). Also transactivates collagenase, CCL20, CLND7, FLG, KRT8, NOS2, PTGS2, SPRR2B, TGFBR2 and TGM3 promoters. Represses KRT4 promoter activity (By similarity). Involved in mediating vascular inflammation. May play an important role in epithelial cell differentiation and tumorigenesis. May be a critical downstream effector of the ERBB2 signaling pathway (By similarity). May be associated with mammary gland development and involution. Plays an important role in the regulation of transcription with TATA-less promoters in preimplantation embryos, which is essential in preimplantation development.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 5' coding region compared to variant 1. The resulting isoform (2) is shorter compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.