Elf3 (NM_007921) Mouse Untagged Clone

CAT#: MC208432

Reviews ()
Write a review

Elf3 (untagged) - Mouse E74-like factor 3 (Elf3), transcript variant 2, (10ug)

  View "NM_007921" in other vectors (6)

USD 410.00


Availability*
3 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Elf3 (NM_007921) Mouse Untagged Clone
Symbol Elf3
Synonyms ESE-1; ESX; jen
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Cell Selection Neomycin
Sequence Data
>MC208432 representing NM_007921
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTGCCACCTGTGAGATCAGCAACGTTTTTAGTAACTACTTCAACGCCATGTACAGCTCAGAAGACC
CCACCCTGGCTCCTGCTCCTCCGACTACCTTTGGCACTGAAGACTTGGTGTTGACCCTGAACAACCAACA
GATGACACTGGAAGGTCCAGAGAAGGCAAGCTGGACTAGCGAGCGGCCCCAGTTCTGGTCGAAGACCCAG
GTTCTGGAGTGGATCAGCTACCAAGTGGAGAAGAACAAGTATGACGCCAGCTCCATCGACTTCTCCCGCT
GCGACATGGACGGAGCCACCCTCTGCAGCTGTGCGCTGGAGGAGCTGCGGCTAGTCTTTGGACCTCTGGG
AGACCAGCTCCATGCCCAGCTTCGGGACCTCACCTCCAACTCTTCTGATGAACTCAGCTGGATCATCGAG
CTGCTGGAGAAGGATGGCATGTCCTTCCAAGAGAGCCTAGGCGACTCGGGCCCCTTTGATCAGGGAAGTC
CTTTTGCCCAGGAACTCCTGGATGATGGCCGCCAGGCCAGTCCCTACTACTGCAGTACCTATGGCCCTGG
AGCGCCCTCCCCCGGCAGCTCTGATGTCTCCACTGCAAGGACCGCTACTCCCCAGAGTTCCCATGCTTCT
GACTCCGGTGGAAGTGATGTGGACCTGGACCTCACCGAGAGCAAGGTCTTCCCTAGAGATGGCTTTCCTG
ACTATAAGAAGGGGGAACCCAAGCACGGGAAGAGGAAACGGGGGCGTCCCAGAAAGCTGAGCAAGGAATA
CTGGGACTGTCTGGAGGGCAAGAAGAGCAAGCACGCCCCCAGAGGTACTCACCTGTGGGAGTTTATCCGA
GACATCCTAATCCACCCCGAGCTCAACGAAGGCCTCATGAAGTGGGAGAACCGGCACGAGGGTGTGTTCA
AGTTTCTTCGCTCAGAGGCCGTGGCCCAACTCTGGGGCCAGAAGAAGAAGAACAGCAACATGACCTATGA
GAAGCTGAGCCGAGCCATGAGGTATTACTACAAACGGGAGATCCTGGAACGGGTGGATGGCCGACGGCTC
GTCTACAAGTTTGGCAAGAACTCTAGTGGCTGGAAGGAAGAAGAGGTTGGAGAGAGTCGGAATTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_007921
ORF Size 1116 bp
Insert Size 1116
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_007921.3, NP_031947
RefSeq Size 1940
RefSeq ORF 1116
Locus ID 13710
Cytogenetics 1 E4

Other Versions

Other products for "Elf3"
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
40% off proteins and antibodies
68 Mouse Clones