Ube2v2 (NM_023585) Mouse Untagged Clone

CAT#: MC207699

Ube2v2 (untagged) - Mouse ubiquitin-conjugating enzyme E2 variant 2 (Ube2v2), transcript variant 1, (10ug)


  "NM_023585" in other vectors (4)

Reconstitution Protocol

USD 165.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Ube2v2"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Ube2v2
Synonyms 1110021H13Rik; 4632410D19Rik; 5730524P06Rik; 6820402M05; AI848315; C81524; MMS2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207699 representing NM_023585
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGGTCTCCACAGGAGTTAAAGTTCCTCGTAATTTTCGCTTGTTGGAAGAACTTGAAGAAGGACAAA
AAGGAGTAGGTGATGGTACTGTTAGCTGGGGCCTTGAAGATGATGAAGACATGACACTTACAAGGTGGAC
AGGCATGATTATTGGGCCACCAAGGACAAACTATGAAAACAGAATATATAGCCTGAAAGTAGAATGTGGA
TCTAAATACCCAGAAGCTCCTCCATCAGTTAGATTTGTAACAAAAATTAATATGAATGGGATCAATAATT
CCAGTGGAATGGTGGATGCACGGAGCATACCAGTATTAGCAAAATGGCAAAATTCCTATAGCATTAAAGT
CATACTTCAAGAGCTAAGACGTCTTATGATGTCCAAAGAAAATATGAAGCTTCCACAGCCTCCAGAAGGA
CAGACGTACAACAACTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_023585
Insert Size 438 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_023585.4, NP_076074.2
RefSeq Size 5892 bp
RefSeq ORF 438 bp
Locus ID 70620
UniProt ID Q9D2M8
Cytogenetics 16 A1- A2
Gene Summary Has no ubiquitin ligase activity on its own. The UBE2V2/UBE2N heterodimer catalyzes the synthesis of non-canonical poly-ubiquitin chains that are linked through 'Lys-63'. This type of poly-ubiquitination does not lead to protein degradation by the proteasome. Mediates transcriptional activation of target genes. Plays a role in the control of progress through the cell cycle and differentiation. Plays a role in the error-free DNA repair pathway and contributes to the survival of cells after DNA damage.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.