Lats2 Mouse Gene Knockout Kit (CRISPR)

CAT#: KN309148RB

Reviews ()
Write a review

Lats2 - mouse gene knockout kit via CRISPR, HDR mediated

HDR-mediated knockout kit validation

  See Other Versions

USD 1,290.00

4 Weeks

    • 1 kit

Product images


Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Symbol Lats2
Locus ID 50523
Kit Components

KN309148G1, Lats2 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GATTGCAAGAGATTCGAGAG

KN309148G2, Lats2 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: CATCCAAGGCTTCCACCCAG

KN309148RB-D, donor DNA containing left and right homologous arms and RFP-BSD functional cassette.

pUC vector backbone in gray; Left arm sequence in blue; RFP-BSD in green; Right arm in violet


GE100003, scramble sequence in pCas-Guide vector

Disclaimer The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_015771, NM_153382
Synonyms 4932411G09Rik; AV277261; AW228608


Other Versions

Other products for "Lats2"
Frequently bought together (1)
Lats2 (Myc-DDK-tagged) - Mouse large tumor suppressor 2 (Lats2), transcript variant B
    • 10 ug

USD 68.00 USD 390.00

Customer Reviews 
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools