VLDL Receptor (VLDLR) Human Gene Knockout Kit (CRISPR)

CAT#: KN211796BN

VLDLR - human gene knockout kit via CRISPR, HDR mediated

Functional Cassette: GFP-puro Luciferase-Puro RFP-BSD mBFP-Neo



HDR-mediated knockout kit validation

  See Other Versions

USD 1,657.00

4 Weeks*

Size
    • 1 kit

Product Images

Frequently bought together (3)
pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
    • 10 ug

USD 450.00


Mouse Monoclonal VLDL Receptor Antibody (6A6)
    • 100 ul

USD 550.00


VLDLR (Myc-DDK-tagged)-Human very low density lipoprotein receptor (VLDLR), transcript variant 1
    • 10 ug

USD 1,199.00

Other products for "VLDL Receptor"

Specifications

Product Data
Format 2 gRNA vectors, 1 mBFP-Neo donor, 1 scramble control
Donor DNA mBFP-Neo
Symbol VLDL Receptor
Locus ID 7436
Components

KN211796G1, VLDL Receptor gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GAGAGCGGCGCCACCGGAAC

KN211796G2, VLDL Receptor gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: CGTCCGCGCTCTGGGCGCTC

KN211796BND, donor DNA containing left and right homologous arms and mBFP-Neo functional cassette.

GE100003, scramble sequence in pCas-Guide vector

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_001018056, NM_003383, NM_001322225, NM_001322226
UniProt ID P98155
Synonyms CAMRQ1; CARMQ1; CHRMQ1; VLDLRCH
Summary The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. This gene encodes a lipoprotein receptor that is a member of the LDLR family and plays important roles in VLDL-triglyceride metabolism and the reelin signaling pathway. Mutations in this gene cause VLDLR-associated cerebellar hypoplasia. Alternative splicing generates multiple transcript variants encoding distinct isoforms for this gene. [provided by RefSeq, Aug 2009]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.