LGALS3BP Human Gene Knockout Kit (CRISPR)

CAT#: KN204918

Reviews ()
Write a review

LGALS3BP - human gene knockout kit via CRISPR, HDR mediated

 HDR-mediated knockout kit validation

USD 1,290.00

2 Weeks

    • 1 kit

Product images


Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Donor DNA GFP-puro
Locus ID 3959
Kit Components

KN204918G1, LGALS3BP gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: TGACCCCTCCGAGGCTCTTC

KN204918G2, LGALS3BP gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TTCTGCTTTTGGTATTTCCC

KN204918-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

pUC vector backbone in gray; Left arm sequence in blue; GFP-puro in green; Right arm in violet


GE100003, scramble sequence in pCas-Guide vector

Disclaimer The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_005567
Synonyms 90K; BTBD17B; CyCAP; gp90; M2BP; MAC-2-BP; TANGO10B
Summary The galectins are a family of beta-galactoside-binding proteins implicated in modulating cell-cell and cell-matrix interactions. LGALS3BP has been found elevated in the serum of patients with cancer and in those infected by the human immunodeficiency virus (HIV). It appears to be implicated in immune response associated with natural killer (NK) and lymphokine-activated killer (LAK) cell cytotoxicity. Using fluorescence in situ hybridization the full length 90K cDNA has been localized to chromosome 17q25. The native protein binds specifically to a human macrophage-associated lectin known as Mac-2 and also binds galectin 1. [provided by RefSeq, Jul 2008]


Other products for "LGALS3BP"
Frequently bought together (2)
LGALS3BP mouse monoclonal antibody, clone OTI3G8 (formerly 3G8)
    • 100 ul

USD 379.00

LGALS3BP (Myc-DDK-tagged)-Human lectin, galactoside-binding, soluble, 3 binding protein (LGALS3BP)
    • 10 ug

USD 480.00

Customer Reviews 
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones