Semaphorin 3B (SEMA3B) (NM_001290063) Human Untagged Clone

CAT#: SC335914

SEMA3B (untagged) - Human sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B (SEMA3B), transcript variant 6


  "NM_001290063" in other vectors (2)

Reconstitution Protocol

USD 503.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


Rabbit Polyclonal SEMA3B Antibody
    • 50 ul

USD 550.00

Other products for "SEMA3B"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SEMA3B
Synonyms LUCA-1; SemA; SEMA5; SEMAA; semaV
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335914 representing NM_001290063.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAACGACGTGCGCCGGGCCTTCTTGGGACCCTTTGCACACAAGGAGGGGCCCATGCACCAGTGGGTG
TCATACCAGGGTCGCGTCCCCTACCCGCGGCCAGGCATGTGCCCCAGCAAGACCTTTGGCACCTTCAGT
TCCACCAAGGACTTCCCAGACGATGTCATCCAGTTTGCGCGGAACCACCCCCTCATGTACAACTCTGTC
CTGCCCACTGGGGGGCGCCCTCTTTTCCTACAAGTTGGAGCCAATTACACCTTCACTCAAATTGCCGCG
GACCGGGTTGCAGCCGCTGACGGACACTATGACGTCCTCTTCATTGGCACAGACGTTGGCACGGTGCTG
AAGGTGATCTCGGTCCCCAAGGGCAGTAGGCCCAGCGCAGAGGGGCTGCTCCTGGAGGAGCTGCACGTG
TTTGAGGACTCGGCCGCTGTCACCAGCATGCAAATTTCTTCCAAGAGGCACCAGCTGTACGTAGCCTCG
CGGAGCGCGGTGGCCCAGATCGCGTTGCACCGCTGCGCTGCCCACGGCCGCGTCTGCACCGAATGCTGT
CTGGCGCGTGACCCCTACTGCGCCTGGGACGGGGTCGCGTGCACGCGCTTCCAGCCCAGTGCCAAGAGG
CGGTTCCGGCGGCAAGACGTAAGGAATGGCGACCCCAGCACGTTGTGCTCCGGAGACTCGTCTCGTCCC
GCGCTGCTGGAACACAAGGTGTTCGGCGTGGAGGGCAGCAGCGCCTTTCTGGAGTGTGAGCCCCGCTCG
CTGCAGGCGCGCGTGGAGTGGACTTTCCAGCGCGCAGGGGTGACAGCCCACACCCAGGTGCTGGCAGAG
GAGCGCACCGAGCGCACCGCCCGGGGACTACTGCTGCGCAGGCTGCGGCGCCGGGACTCGGGCGTGTAC
TTGTGCGCCGCCGTCGAGCAGGGCTTTACGCAACCGCTGCGTCGCCTGTCGCTGCACGTGTTGAGTGCT
ACGCAGGCCGAACGACTGGCGCGGGCCGAGGAGGCTGCGCCCGCCGCGCCGCCGGGCCCCAAACTCTGG
TACCGGGACTTTCTGCAGCTGGTGGAGCCGGGCGGAGGTGGCAGCGCGAACTCCCTGCGCATGTGCCGC
CCGCAGCCTGCGCTGCAGTCACTGCCCCTGGAGTCGCGGAGAAAGGGCCGTAACCGGAGGACCCACGCC
CCTGAGCCTCGCGCTGAGCGGGGGCCGCGCAGCGCAACGCACTGGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001290063
Insert Size 1221 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001290063.1
RefSeq Size 2121 bp
RefSeq ORF 1221 bp
Locus ID 7869
UniProt ID Q13214
Cytogenetics 3p21.31
Protein Families Secreted Protein, Transmembrane
Protein Pathways Axon guidance
MW 45 kDa
Gene Summary The protein encoded by this gene belongs to the class-3 semaphorin/collapsin family, whose members function in growth cone guidance during neuronal development. This family member inhibits axonal extension and has been shown to act as a tumor suppressor by inducing apoptosis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2014]
Transcript Variant: This variant (6) lacks several 5' exons but contains alternate 5' exon structure, and it thus differs in its 5' UTR and initiates translation from a downstream in-frame start codon, compared to variant 1. The encoded isoform (4) is shorter at the N-terminus, compared to isoform 1. Both variants 5 and 6 encode isoform 4.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.