Nck (NCK1) (NM_001291999) Human Untagged Clone

CAT#: SC335736

NCK1 (untagged) - Human NCK adaptor protein 1 (NCK1), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NCK1
• Synonyms: NCK; nck-1; NCKalpha
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC335736 representing NM_001291999.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGGCAGAAGAAGTGGTGGTAGTAGCCAAATTTGATTATGTGGCCCAACAAGAACAAGAGTTGGACATC
  AAGAAGAATGAGAGATTATGGCTTCTGGATGATTCTAAGTCCTGGTGGCGAGTTCGAAATTCCATGAAT
  AAAACAGGTTTTGTGCCTTCTAACTATGTGGAAAGGAAAAACAGTGCTCGGAAAGCATCTATTGTGAAA
  AACCTAAAGGATACCTTAGGCATTGGAAAAGTGAAAAGAAAACCTAGTGTGCCAGATTCTGCATCTCCT
  GCTGATGATAGTTTTGTTGACCCAGGGGAACGTCTCTATGACCTCAACATGCCCGCTTATGTGAAATTT
  AACTACATGGCTGAGAGAGAGGATGAATTATCATTGATAAAGGGGACAAAGGTGATCGTCATGGAGAAA
  TGCAGTGATGGGTGGTGGCGTGGTAGCTACAATGGACAAGTTGGATGGTTCCCTTCAAACTATGTAACT
  GAAGAAGGTGACAGTCCTTTGGGTGACCATGTGGGTTCTCTGTCAGAGAAATTAGCAGCAGTCGTCAAT
  AACCTAAATACTGGGCAAGTGTTGCATGTGGTACAGGCTCTTTACCCATTCAGCTCATCTAATGATGAA
  GAACTTAATTTCGAGAAAGGAGATGTAATGGATGTTATTGAAAAACCTGAAAATGACCCAGAGTGGTGG
  AAATGCAGGAAGATCAATGGTATGGTTGGTCTAGTACCAAAAAACTATGTTACCGTTATGCAGAATAAT
  CCATTAACTTCAGGTTTGGAACCATCACCTCCACAGTGTGATTACATTAGGCCTTCACTCACTGGAAAG
  TTTGCTGGCAATCCTTGGTATTATGGCAAAGTCACCAGGCATCAAGCAGAAATGGCATTAAATGAAAGA
  GGACATGAAGGGGATTTCCTCATTCGTGATAGTGAATCTTCGCCAAATGATTTCTCAGTATCACTAAAA
  GCACAAGGGAAAAACAAGCATTTTAAAGTCCAACTAAAAGAGACTGTCTACTGCATTGGGCAGCGTAAA
  TTCAGCACCATGGAAGAACTTGTAGAACATTACAAAAAGGCACCAATTTTTACAAGTGAACAAGGAGAA
  AAATTATATCTTGTCAAGCATTTATCATGA
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001291999
• Insert Size: 1134 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001291999.1
• RefSeq Size: 4455 bp
• RefSeq ORF: 1134 bp
• Locus ID: 4690
• UniProt ID: P16333
• Cytogenetics: 3q22.3
• Protein Families: Druggable Genome
• Protein Pathways: Axon guidance, ErbB signaling pathway, Pathogenic Escherichia coli infection, T cell receptor signaling pathway
• MW: 42.9 kDa
• Gene Summary: The protein encoded by this gene is one of the signaling and transforming proteins containing Src homology 2 and 3 (SH2 and SH3) domains. It is located in the cytoplasm and is an adaptor protein involved in transducing signals from receptor tyrosine kinases to downstream signal recipients such as RAS. Alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, Jun 2010]
  Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1 and 3 encode the same protein (isoform 1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.