MDM2 (NM_001278462) Human Untagged Clone

CAT#: SC335322

MDM2 (untagged) - Human MDM2 proto-oncogene, E3 ubiquitin protein ligase (MDM2), transcript variant 5


  "NM_001278462" in other vectors (2)

Reconstitution Protocol

USD 330.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
MDM2 mouse monoclonal antibody, clone OTI1E6 (formerly 1E6)
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "MDM2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MDM2
Synonyms ACTFS; hdm2; HDMX; LSKB
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335322 representing NM_001278462.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTGCAATACCAACATGTCTGTACCTACTGATGGTGCTGTAACCACCTCACAGATTCCAGCTTCGGAA
CAAGAGACCCTGGTTAGACCAAAGCCATTGCTTTTGAAGTTATTAAAGTCTGTTGGTGCACAAAAAGAC
ACTTATACTATGAAAGAGGATCTTGATGCTGGTGTAAGTGAACATTCAGGTGATTGGTTGGATCAGGAT
TCAGTTTCAGATCAGTTTAGTGTAGAATTTGAAGTTGAATCTCTCGACTCAGAAGATTATAGCCTTAGT
GAAGAAGGACAAGAACTCTCAGATGAAGATGATGAGGTATATCAAGTTACTGTGTATCAGGCAGGGGAG
AGTGATACAGATTCATTTGAAGAAGATCCTGAAATTTCCTTAGCTGACTATTGGAAATGCACTTCATGC
AATGAAATGAATCCCCCCCTTCCATCACATTGCAACAGATGTTGGGCCCTTCGTGAGAATTGGCTTCCT
GAAGATAAAGGGAAAGATAAAGGGGAAATCTCTGAGAAAGCCAAACTGGAAAACTCAACACAAGCTGAA
GAGGGCTTTGATGTTCCTGATTGTAAAAAAACTATAGTGAATGATTCCAGAGAGTCATGTGTTGAGGAA
AATGATGATAAAATTACACAAGCTTCACAATCACAAGAAAGTGAAGACTATTCTCAGCCATCAACTTCT
AGTAGCATTATTTATAGCAGCCAAGAAGATGTGAAAGAGTTTGAAAGGGAAGAAACCCAAGACAAAGAA
GAGAGTGTGGAATCTAGTTTGCCCCTTAATGCCATTGAACCTTGTGTGATTTGTCAAGGTCGACCTAAA
AATGGTTGCATTGTCCATGGCAAAACAGGACATCTTATGGCCTGCTTTACATGTGCAAAGAAGCTAAAG
AAAAGGAATAAGCCCTGCCCAGTATGTAGACAACCAATTCAAATGATTGTGCTAACTTATTTCCCCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001278462
Insert Size 966 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001278462.1
RefSeq Size 6735 bp
RefSeq ORF 966 bp
Locus ID 4193
UniProt ID Q00987
Cytogenetics 12q15
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Bladder cancer, Cell cycle, Chronic myeloid leukemia, Endocytosis, Glioma, Melanoma, p53 signaling pathway, Pathways in cancer, Prostate cancer, Ubiquitin mediated proteolysis
MW 36 kDa
Gene Summary This gene encodes a nuclear-localized E3 ubiquitin ligase. The encoded protein can promote tumor formation by targeting tumor suppressor proteins, such as p53, for proteasomal degradation. This gene is itself transcriptionally-regulated by p53. Overexpression or amplification of this locus is detected in a variety of different cancers. There is a pseudogene for this gene on chromosome 2. Alternative splicing results in a multitude of transcript variants, many of which may be expressed only in tumor cells. [provided by RefSeq, Jun 2013]
Transcript Variant: This variant (5, also known as P2-MDM2-C) contains multiple differences in the 5' UTR and coding region, compared to variant 1. It uses an alternate promoter and initiates translation at a downstream in-frame start codon. The encoded isoform (l) has a shorter N-terminus and is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.