Integrin Linked Kinase (ILK) (NM_001278442) Human Untagged Clone

CAT#: SC335308

ILK (untagged) - Human integrin-linked kinase (ILK), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: Integrin Linked Kinase
• Synonyms: HEL-S-28; ILK-1; ILK-2; P59; p59ILK
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC335308 representing NM_001278442.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGCCTGTGGACAAAGCCAAGGCACCCCTGAGAGAGCTTCTCCGAGAGCGGGCAGAGAAGATGGGCCAG
  AATCTCAACCGTATTCCATACAAGGACACATTCTGGAAGGGGACCACCCGCACTCGGCCCCGAAATGGA
  ACCCTGAACAAACACTCTGGCATTGACTTCAAACAGCTTAACTTCCTGACGAAGCTCAACGAGAATCAC
  TCTGGAGAGCTATGGAAGGGCCGCTGGCAGGGCAATGACATTGTCGTGAAGGTGCTGAAGGTTCGAGAC
  TGGAGTACAAGGAAGAGCAGGGACTTCAATGAAGAGTGTCCCCGGCTCAGGATTTTCTCGCATCCAAAT
  GTGCTCCCAGTGCTAGGTGCCTGCCAGTCTCCACCTGCTCCTCATCCTACTCTCATCACACACTGGATG
  CCGTATGGATCCCTCTACAATGTACTACATGAAGGCACCAATTTCGTCGTGGACCAGAGCCAGGCTGTG
  AAGTTTGCTTTGGACATGGCAAGGGGCATGGCCTTCCTACACACACTAGAGCCCCTCATCCCACGACAT
  GCACTCAATAGCCGTAGTGTAATGATTGATGAGGACATGACTGCCCGAATTAGCATGGCTGATGTCAAG
  TTCTCTTTCCAATGTCCTGGTCGCATGTATGCACCTGCCTGGGTAGCCCCCGAAGCTCTGCAGAAGAAG
  CCTGAAGACACAAACAGACGCTCAGCAGACATGTGGAGTTTTGCAGTGCTTCTGTGGGAACTGGTGACA
  CGGGAGGTACCCTTTGCTGACCTCTCCAATATGGAGATTGGAATGAAGGTGGCATTGGAAGGCCTTCGG
  CCTACCATCCCACCAGGTATTTCCCCTCATGTGTGTAAGCTCATGAAGATCTGCATGAATGAAGACCCT
  GCAAAGCGACCCAAATTTGACATGATTGTGCCTATCCTTGAGAAGATGCAGGACAAGTAG
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001278442
• Insert Size: 957 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001278442.1
• RefSeq Size: 1631 bp
• RefSeq ORF: 957 bp
• Locus ID: 3611
• UniProt ID: Q13418
• Cytogenetics: 11p15.4
• Protein Families: Druggable Genome, Protein Kinase
• Protein Pathways: Endometrial cancer, Focal adhesion, PPAR signaling pathway
• MW: 36.5 kDa
• Gene Summary: This gene encodes a protein with a kinase-like domain and four ankyrin-like repeats. The encoded protein associates at the cell membrane with the cytoplasmic domain of beta integrins, where it regulates integrin-mediated signal transduction. Activity of this protein is important in the epithelial to mesenchymal transition, and over-expression of this gene is implicated in tumor growth and metastasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
  Transcript Variant: This variant (5) uses an alternate splice site in the 5' UTR, lacks an exon in the 5' coding region, and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (3) has a shorter N-terminus, compared to isoform 1.