CRF1 (CRHR1) (NM_001303020) Human Untagged Clone

CAT#: SC335284

CRHR1 (untagged) - Human corticotropin releasing hormone receptor 1 (CRHR1), transcript variant 1i


  "NM_001303020" in other vectors (2)

Reconstitution Protocol

USD 330.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-CRHR1 Antibody (N-Terminus)
    • 50 ug

USD 515.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "CRF1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CRF1
Synonyms CRF-R; CRF-R-1; CRF-R1; CRF1; CRFR-1; CRFR1; CRH-R-1; CRH-R1; CRHR; CRHR1L
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335284 representing NM_001303020.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGTGTCCGCTACAATACCACAAAAAAAAAGCAAGGTGCACTACCATGTCGCAGTCATCATCAACTAC
CTGGGCCACTGTATCTCCCTGGTGGCCCTCCTGGTGGCCTTTGTCCTCTTTCTGCGGCTCAGGAGCATC
CGGTGCCTGCGAAACATCATCCACTGGAACCTCATCTCCGCCTTCATCCTGCGCAACGCCACCTGGTTC
GTGGTCCAGCTAACCATGAGCCCCGAGGTCCACCAGAGCAACGTGGGCTGGTGCAGGTTGGTGACAGCC
GCCTACAACTACTTCCATGTGACCAACTTCTTCTGGATGTTCGGCGAGGGCTGCTACCTGCACACAGCC
ATCGTGCTCACCTACTCCACTGACCGGCTGCGCAAATGGATGTTCATCTGCATTGGCTGGGGTGTGCCC
TTCCCCATCATTGTGGCCTGGGCCATTGGGAAGCTGTACTACGACAATGAGAAGTGCTGGTTTGGCAAA
AGGCCTGGGGTGTACACCGACTACATCTACCAGGGCCCCATGATCCTGGTCCTGCTGATCAATTTCATC
TTCCTTTTCAACATCGTCCGCATCCTCATGACCAAGCTCCGGGCATCCACCACGTCTGAGACCATTCAG
TACAGGAAGGCTGTGAAAGCCACTCTGGTGCTGCTGCCCCTCCTGGGCATCACCTACATGCTGTTCTTC
GTCAATCCCGGGGAGGATGAGGTCTCCCGGGTCGTCTTCATCTACTTCAACTCCTTCCTGGAATCCTTC
CAGGGCTTCTTTGTGTCTGTGTTCTACTGTTTCCTCAATAGTGAGGTCCGTTCTGCCATCCGGAAGAGG
TGGCACCGGTGGCAGGACAAGCACTCGATCCGTGCCCGAGTGGCCCGTGCCATGTCCATCCCCACCTCC
CCAACCCGTGTCAGCTTTCACAGCATCAAGCAGTCCACAGCAGTCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001303020
Insert Size 945 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001303020.1
RefSeq Size 2508 bp
RefSeq ORF 945 bp
Locus ID 1394
Cytogenetics 17q21.31
Protein Families Druggable Genome, GPCR, Transmembrane
Protein Pathways Long-term depression, Neuroactive ligand-receptor interaction
MW 36.6 kDa
Gene Summary This gene encodes a G-protein coupled receptor that binds neuropeptides of the corticotropin releasing hormone family that are major regulators of the hypothalamic-pituitary-adrenal pathway. The encoded protein is essential for the activation of signal transduction pathways that regulate diverse physiological processes including stress, reproduction, immune response and obesity. Alternative splicing results in multiple transcript variants. Naturally-occurring readthrough transcription between this gene and upstream GeneID:147081 results in transcripts that encode isoforms that share similarity with the products of this gene. [provided by RefSeq, Aug 2016]
Transcript Variant: This variant (1i) lacks two alternate exons, and it thus differs in its 5' UTR and initiates translation at an alternate start codon, compared to variant 1b. The encoded isoform (1i-B) is shorter and has a distinct N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.