NANOG (NM_001297698) Human Untagged Clone
CAT#: SC335117
NANOG (untagged) - Human Nanog homeobox (NANOG), transcript variant 2
"NM_001297698" in other vectors (2)
Product Images
Frequently bought together (4)
Other products for "NANOG"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | NANOG |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001297698, the custom clone sequence may differ by one or more nucleotides
ATGAGTGTGGATCCAGCTTGTCCCCAAAGCTTGCCTTGCTTTGAAGCATCCGACTGTAAAGAATCTTCAC CTATGCCTGTGATTTGTGGGCCTGAAGAAAACTATCCATCCTTGCAAATGTCTTCTGCTGAGATGCCTCA CACGGAGACTGTCTCTCCTCTTCCTTCCTCCATGGATCTGCTTATTCAGGACAGCCCTGATTCTTCCACC AGTCCCAAAGGCAAACAACCCACTTCTGCAGAGAAGAGTGTCGCAAAAAAGGAAGACAAGGTCCCGGTCA AGAAACAGAAGACCAGAACTGTGTTCTCTTCCACCCAGCTGTGTGTACTCAATGATAGATTTCAGAGACA GAAATACCTCAGCCTCCAGCAGATGCAAGAACTCTCCAACATCCTGAACCTCAGCTACAAACAGGTGAAG ACCTGGTTCCAGAACCAGAGAATGAAATCTAAGAGGTGGCAGAAAAACAACTGGCCGAAGAATAGCAATG GTGTGACGCAGGGATGCCTGGTGAACCCGACTGGGAACCTTCCAATGTGGAGCAACCAGACCTGGAACAA TTCAACCTGGAGCAACCAGACCCAGAACATCCAGTCCTGGAGCAACCACTCCTGGAACACTCAGACCTGG TGCACCCAATCCTGGAACAATCAGGCCTGGAACAGTCCCTTCTATAACTGTGGAGAGGAATCTCTGCAGT CCTGCATGCAGTTCCAGCCAAATTCTCCTGCCAGTGACTTGGAGGCTGCCTTGGAAGCTGCTGGGGAAGG CCTTAATGTAATACAGCAGACCACTAGGTATTTTAGTACTCCACAAACCATGGATTTATTCCTAAACTAC TCCATGAACATGCAACCTGAAGACGTGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001297698 |
Insert Size | 867 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001297698.1, NP_001284627.1 |
RefSeq Size | 2055 bp |
RefSeq ORF | 870 bp |
Locus ID | 79923 |
UniProt ID | Q9H9S0 |
Cytogenetics | 12p13.31 |
Protein Families | Cancer stem cells, Embryonic stem cells, ES Cell Differentiation/IPS, Induced pluripotent stem cells, Stem cell - Pluripotency |
Gene Summary | The protein encoded by this gene is a DNA binding homeobox transcription factor involved in embryonic stem (ES) cell proliferation, renewal, and pluripotency. The encoded protein can block ES cell differentiation and can also autorepress its own expression in differentiating cells. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015] Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 3' coding region compared to variant 1. The encoded isoform (2) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.