PRKACB (NM_001300915) Human Untagged Clone
CAT#: SC334916
PRKACB (untagged) - Human protein kinase, cAMP-dependent, catalytic, beta (PRKACB), transcript variant 10
"NM_001300915" in other vectors (2)
Product Images
Frequently bought together (4)
Other products for "PRKACB"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PRKACB |
Synonyms | CAFD2; PKA C-beta; PKACB |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001300915, the custom clone sequence may differ by one or more nucleotides
ATGAGTGCACGCAAATCATCAGATGCATCTGCTTGCTCCTCTTCAGAAATATCTGATTCCTTTGTGAAAG AGTTTCTAGCCAAAGCCAAAGAAGACTTTTTGAAAAAATGGGAGAATCCAACTCAGAATAATGCCGGACT TGAAGATTTTGAAAGGAAAAAAACCCTTGGAACAGGTTCATTTGGAAGAGTCATGTTGGTAAAACACAAA GCCACTGAACAGTATTATGCCATGAAGATCTTAGATAAGCAGAAGGTTGTTAAACTGAAGCAAATAGAGC ATACTTTGAATGAGAAAAGAATATTACAGGCAGTGAATTTTCCTTTCCTTGTTCGACTGGAGTATGCTTT TAAGGATAATTCTAATTTATACATGGTTATGGAATATGTCCCTGGGGGTGAAATGTTTTCACATCTAAGA AGAATTGGAAGGTTCAGTGAGCCCCATGCACGGTTCTATGCAGCTCAGATAGTGCTAACATTCGAGTACC TCCATTCACTAGACCTCATCTACAGAGATCTAAAACCTGAAAATCTCTTAATTGACCATCAAGGCTATAT CCAGGTCACAGACTTTGGGTTTGCCAAAAGAGTTAAAGGCAGAACTTGGACATTATGTGGAACTCCAGAG TATTTGGCTCCAGAAATAATTCTCAGCAAGGGCTACAATAAGGCAGTGGATTGGTGGGCATTAGGAGTGC TAATCTATGAAATGGCAGCTGGCTATCCCCCATTCTTTGCAGACCAACCAATTCAGATTTATGAAAAGAT TGTTTCTGGAAAGCAGAACTTTTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001300915 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001300915.1, NP_001287844.1 |
RefSeq Size | 2156 bp |
RefSeq ORF | 795 bp |
Locus ID | 5567 |
UniProt ID | P22694 |
Cytogenetics | 1p31.1 |
Protein Families | Druggable Genome, Protein Kinase |
Protein Pathways | Apoptosis, Calcium signaling pathway, Chemokine signaling pathway, Dilated cardiomyopathy, Gap junction, GnRH signaling pathway, Hedgehog signaling pathway, Insulin signaling pathway, Long-term potentiation, MAPK signaling pathway, Melanogenesis, Olfactory transduction, Oocyte meiosis, Prion diseases, Progesterone-mediated oocyte maturation, Taste transduction, Vascular smooth muscle contraction, Vibrio cholerae infection, Wnt signaling pathway |
Gene Summary | The protein encoded by this gene is a member of the serine/threonine protein kinase family. The encoded protein is a catalytic subunit of cAMP (cyclic AMP)-dependent protein kinase, which mediates signalling though cAMP. cAMP signaling is important to a number of processes, including cell proliferaton and differentiation. Multiple alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2014] Transcript Variant: This variant (10) differs in both the 5' and 3' exon structures, compared to variant 1. The encoded isoform (10) has distinct N- and C-termini and is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.