BATF2 (NM_001300807) Human Untagged Clone

CAT#: SC334824

BATF2 (untagged) - Human basic leucine zipper transcription factor, ATF-like 2 (BATF2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: BATF2
• Synonyms: SARI
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001300807, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCTCCTGTGGGCAAGAGAATAGGTGGTTTGGGGGACACACGGGTTGGAGGCCCGTGCATATCCCAGC
  AGCACGAGTCTCTGGAAAAAGACAACCTCGCCCTGCGGAAGGAGATCCAGTCCCTGCAGGCCGAGCTGGC
  GTGGTGGAGCCGGACCCTGCACGTGCATGAGCGCCTGTGCCCCATGGATTGTGCCTCCTGCTCAGCTCCA
  GGGCTCCTGGGCTGCTGGGACCAGGCTGAGGGGCTCCTGGGCCCTGGCCCACAGGGACAACATGGCTGCC
  GGGAGCAGCTGGAGCTGTTCCAGACCCCGGGTTCCTGTTACCCAGCTCAGCCGCTCTCTCCAGGTCCACA
  GCCTCATGATTCTCCCAGCCTCCTCCAGTGCCCCCTGCCCTCACTGTCCCTTGGCCCCGCTGTGGTTGCT
  GAACCTCCTGTCCAGCTGTCCCCCAGCCCTCTCCTGTTTGCCTCGCACACTGGTTCCAGCCTGCAGGGGT
  CTTCCTCTAAGCTCAGTGCCCTCCAGCCCAGCCTCACGGCCCAAACTGCCCCTCCACAGCCCCTCGAGCT
  GGAGCATCCCACCAGAGGGAAGCTGGGGTCCTCTCCCGACAACCCTTCCTCTGCCCTGGGGCTTGCACGT
  CTGCAGAGCAGGGAGCACAAACCTGCTCTCTCAGCAGCCACTTGGCAAGGGCTGGTTGTGGATCCCAGCC
  CTCACCCTCTCCTGGCCTTTCCTCTGCTCTCCTCTGCTCAAGTCCACTTCTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001300807
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001300807.1, NP_001287736.1
• RefSeq Size: 2074 bp
• RefSeq ORF: 753 bp
• Locus ID: 116071
• UniProt ID: Q8N1L9
• Cytogenetics: 11q13.1
• Protein Families: Transcription Factors
• Gene Summary: AP-1 family transcription factor that controls the differentiation of lineage-specific cells in the immune system. Following infection, participates in the differentiation of CD8(+) thymic conventional dendritic cells in the immune system. Acts via the formation of a heterodimer with JUN family proteins that recognizes and binds DNA sequence 5'-TGA[CG]TCA-3' and regulates expression of target genes (By similarity). Selectively suppresses CCN1 transcription and hence blocks the downstream cell proliferation signals produced by CCN1 and inhibits CCN1-induced anchorage-independent growth and invasion in several cancer types, such as breast cancer, malignant glioma and metastatic melanoma. Possibly acts by interfering with AP-1 binding to CCN1 promoter.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) has an alternate exon in place of the first two exons compared to variant 1. The resulting isoform (2) has a shorter and distinct N-terminus compared to isoform 1.